Agonopterix flavicomella

Engel, 1907 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records95

Data sources7

Biological traits0

DNA specimens14

eDNA detections19

Sources7 archives

Databases and archives Agonopterix flavicomella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility95 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF95 records

Environmental DNA1 datasets · 2 countries19 detections

DNA & barcodingBOLD14 specimens

01Narrative

Agonopterix flavicomella is a moth of the family Depressariidae. It is found in North America, where it has been recorded from Alabama, Georgia, Illinois, Indiana, Kentucky, Maine, Michigan, Minnesota, North Carolina, Ohio, Tennessee, Virginia and West Virginia.mothphotographersgroup The wingspan is about 16 mm. Adults are on wing from April to August and in October. The larvae feed on Heracleum lanatum and Taenidia integerrima.Agonopterix at funet

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix flavicomella has left across the world's sequence archives.

At a glance

DNA specimens14

BINs2

Marker genes1

eDNA detections19

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 65 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

6Tmostly conserved

7Amostly conserved

9Amostly conserved

11Tmostly conserved

14Amostly conserved

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

20Gmostly conserved

21Gmostly conserved

22Amostly conserved

23Amostly conserved

24Tmostly conserved

25Tmostly conserved

26Tmostly conserved

27Gmostly conserved

30Cmostly conserved

32Gmostly conserved

33Gmostly conserved

35Amostly conserved

37Amostly conserved

38Gmostly conserved

39Tmostly conserved

40Tmostly conserved

41Gmostly conserved

42Gmostly conserved

44Amostly conserved

46Amostly conserved

48Cmostly conserved

49Tmostly conserved

50Tmostly conserved

51Tmostly conserved

52Amostly conserved

53Amostly conserved

54Gmostly conserved

59Tmostly conserved

61Amostly conserved

62Amostly conserved

63Tmostly conserved

65Cmostly conserved

66Gmostly conserved

69Cmostly conserved

70Tmostly conserved

71Gmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

76Amostly conserved

77Gmostly conserved

78Gmostly conserved

82Tmostly conserved

121Tmostly conserved

157Tmostly conserved

235Cmostly conserved

271Tmostly conserved

274Tvariable

287Tmostly conserved

304Tvariable

368Gmostly conserved

578Tmostly conserved

580Amostly conserved

581Cmostly conserved

589Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGATTATTAATTCGTGCTGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes3

BINs2

Most divergent pair2.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix carduncellisame genus2.6%Agonopterix kayseriensissame genus2.7%Agonopterix multiplicellasame genus2.7%Agonopterix alpigenasame genus2.9%Agonopterix babaellasame genus3.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type95 records

Wild obs. + sensor14

Museum / vouchered81

Range

Area of Occupancy AOO148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy42% within 1 km

≤100 m 2≤1 km 3≤10 km 3>10 km 4

12 georeferenced · 2 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤1 km 7≤10 km 15>10 km 4

26 georeferenced · 55 without coordinates

Open the institutions mapphysical evidence81

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
North Carolina State University Insect Museumlocation not on record	31
East Lansing, US	21
Washington, US	16
Philadelphia, US	5
St. Paul, US	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

7 institutions · 80 of 81 vouchered records shown · 1 without an institution code

09Environmental DNA19 detections

Where the DNA of Agonopterix flavicomella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map2 countries0

Mixed habitatGrassland1. Forest & Woodland | 1.4. Temperate Forest1. Forest & WoodlandForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C 14.7–22.9

Seasonal swing summer↔winter23.2 °C

Max temp (day)23.2 °C 17.0–28.2

Min temp (night)11.2 °C 10.5–16.7

Precipitation87.3 mm/mo 7.50–111

Air humidity58.4 % 45.7–61.4

Moisture balance-58.5 mm/mo -148–-7.90

Vapour deficit882 Pa 643–1,196

Wind speed2.40 m/s 1.80–2.80

Cloud cover33.2 % 16.3–54.1

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)