Agonopterix canadensis

Busck, 1902 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records471

Data sources7

Biological traits0

DNA specimens139

eDNA detections1 050

Sources7 archives

Databases and archives Agonopterix canadensis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility471 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 050 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics139 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF471 records

Environmental DNA1 datasets · 52 countries1 050 detections

DNA & barcodingBOLD139 specimens

01Narrative

Agonopterix canadensis, the Canadian agonopterix, is a moth of the family Depressariidae. It is found from the north-eastern United States and southern Canada, south through the Rocky Mountains to Colorado, the Basin Range and the mountains of central California and Nevada.Bug Guide The length of the forewings is 8.5-10.5 mm. The larvae feed on Senecio species, including Senecio serra.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding139 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix canadensis has left across the world's sequence archives.

At a glance

DNA specimens139

BINs2

Marker genes1

eDNA detections1 050

Countries52

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P649 bp consensus123 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 40 variable positions, in barcode order

43Amostly conserved

70Cmostly conserved

74Cmostly conserved

85Tmostly conserved

106Cmostly conserved

127Gmostly conserved

139Tmostly conserved

184Amostly conserved

229Amostly conserved

263Cmostly conserved

271Cmostly conserved

274Cvariable

277Amostly conserved

286Cvariable

287Cmostly conserved

322Tmostly conserved

340Cmostly conserved

364Tmostly conserved

367Cvariable

368Gmostly conserved

376Cmostly conserved

386Tmostly conserved

400Tmostly conserved

403Avariable

415Amostly conserved

421Tvariable

451Tmostly conserved

460Tmostly conserved

481Amostly conserved

499Cmostly conserved

500Tmostly conserved

508Tmostly conserved

533Tmostly conserved

562Gmostly conserved

568Tmostly conserved

574Amostly conserved

586Amostly conserved

592Amostly conserved

616Tmostly conserved

625Amostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTTGGAACATCTTTAAGATTATTAATTCGTGCCGAACTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.2%

Haplotypes13

BINs2

Most divergent pair9.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix straminellasame genus4.0%Agonopterix kayseriensissame genus4.2%Agonopterix parilellasame genus4.3%Agonopterix scopariellasame genus4.3%Agonopterix pseudoferulaesame genus4.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type471 records

Wild obs. + sensor215

Museum / vouchered256

Range

Area of Occupancy AOO860 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 112≤1 km 23≤10 km 21>10 km 9

165 georeferenced · 50 without coordinates

Open the mapobservation + sensor215

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 7≤1 km 10≤10 km 10

27 georeferenced · 229 without coordinates

Open the institutions mapphysical evidence256

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	53
University of Alberta Museums (UAM)location not on record	41
North Carolina State University Insect Museumlocation not on record	27
East Lansing, US	11
Philadelphia, US	8
Mississippi State, US	8
Washington, US	8
San Francisco, US	7
Vernal, US	5
Research Collection of Daniel Handfieldlocation not on record	2
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Georgia Museum of Natural Historylocation not on record	1
Cornell University Insect Collectionlocation not on record	1

13 institutions · 173 of 256 vouchered records shown · 83 without an institution code

09Environmental DNA1 050 detections

Where the DNA of Agonopterix canadensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 050

Studies independent surveys1

Countries52

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 050 detections have coordinates

Open the map52 countries0

WetlandMixed habitat4. Native GrasslandGrassland14. Artificial - Terrestrial | 14.2 Pasturel…Hardwoods

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 5.60–21.1

Seasonal swing summer↔winter23.0 °C

Max temp (day)18.0 °C 9.80–25.7

Min temp (night)8.90 °C 1.40–16.4

Precipitation76.1 mm/mo 27.2–140

Air humidity57.7 % 52.2–63.1

Moisture balance-21.0 mm/mo -123–59.3

Vapour deficit673 Pa 375–1,151

Wind speed3.20 m/s 2.00–5.20

Cloud cover40.4 % 26.1–51.4

CHELSA 1981–2010, ~9 km grid, at location & month of 1 026 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)