Agonopterix atrodorsella

Clemens, 1863 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records615

Data sources7

Biological traits0

DNA specimens15

eDNA detections15

Sources7 archives

Databases and archives Agonopterix atrodorsella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility615 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF615 records

Environmental DNA1 datasets · 1 countries15 detections

DNA & barcodingBOLD15 specimens

01Narrative

Agonopterix atrodorsella is a moth in the family Depressariidae. It was described by James Brackenridge Clemens in 1863. It is found in North America, where it has been recorded from Illinois, Indiana, Kentucky, Maine, Maryland, Massachusetts, Michigan, New Brunswick, New Hampshire, New York, North Carolina, Ohio, Ontario, Quebec and Wisconsin.Moth Photographers Group. Mississippi State University. The wingspan is 18–23 mm. The forewings are yellow ochreous with several black costal dots from the base to the tip of the wing. There is a black dot on the basal portion of the disc with a rufous patch beyond this. The hindwings are yellowish.Proceedings of the Entomological Society of Philadelphia 2: 124 Adults have been recorded in all months of the year depending on the collection locality. There is however only one generation per year.Bug Guide The larvae feed on Eupatorium and Coreopsis species, as well as Bidens frondosa and Myrica asplenifolia. The species overwinters as an adult.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix atrodorsella has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections15

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

34Amostly conserved

262Avariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGATTATTAATTCGTGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.10%

Haplotypes3

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix straminellasame genus3.3%Agonopterix eupatoriiellasame genus3.5%Agonopterix broennoeensissame genus4.0%Agonopterix ochrocephalasame genus4.0%Agonopterix multiplicellasame genus4.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type615 records

Wild obs. + sensor564

Museum / vouchered51

Range

Area of Occupancy AOO1 176 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 393≤1 km 73≤10 km 17>10 km 35

518 georeferenced · 46 without coordinates

Open the mapobservation + sensor564

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 1≤1 km 17≤10 km 9>10 km 3

30 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence51

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	18
Cornell University Insect Collectionlocation not on record	5
UNHClocation not on record	5
New Haven, US	4
St. Paul, US	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Philadelphia, US	2
Cambridge, US	2
SOVTlocation not on record	2
University of Guelphlocation not on record	1

10 institutions · 44 of 51 vouchered records shown · 7 without an institution code

09Environmental DNA15 detections

Where the DNA of Agonopterix atrodorsella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map1 country0

Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.5 °C 6.60–16.3

Seasonal swing summer↔winter30.8 °C

Max temp (day)18.8 °C 12.0–20.4

Min temp (night)8.00 °C 1.20–13.8

Precipitation82.1 mm/mo 62.9–101

Air humidity56.6 % 55.1–59.5

Moisture balance-18.1 mm/mo -46.4–9.00

Vapour deficit670 Pa 436–736

Wind speed3.40 m/s 2.90–4.20

Cloud cover50.1 % 47.3–53.7

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)