Agonopterix eupatoriiella

Chambers, 1878 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records88

Data sources7

Biological traits0

DNA specimens33

eDNA detections32

Sources7 archives

Databases and archives Agonopterix eupatoriiella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility88 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF88 records

Environmental DNA1 datasets · 2 countries32 detections

DNA & barcodingBOLD33 specimens

01Narrative

Agonopterix eupatoriiella is a moth in the family Depressariidae. It was described by Vactor Tousey Chambers in 1878. It is found in North America, where it has been recorded from Illinois, Kentucky, Maryland, Michigan, Minnesota, Mississippi, Missouri, North Carolina, Ohio, Quebec, Tennessee and Wisconsin.Moth Photographers Group at Mississippi State University The wingspan is about 24 mm.Proceedings of the United States National Museum 35 (1644): 199 The forewings are dark to fuscous grey, dusted with blackish, forming small streaks along the costa. The hindwings are pale greyish, with a faint purplish lustre.Bulletin of the United States Geological and Geographical Survey of the Territories 4: 82 The larvae feed on Eupatorium species, Actinomeris alternifolia and Carya ovata.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix eupatoriiella has left across the world's sequence archives.

At a glance

DNA specimens33

BINs3

Marker genes1

eDNA detections32

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P636 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

24Tvariable

42Amostly conserved

81Tvariable

99Avariable

126Tvariable

168Avariable

231Amostly conserved

276Amostly conserved

282Cvariable

339Tvariable

360Cvariable

420Tmostly conserved

435Tmostly conserved

469Tvariable

507Amostly conserved

564Avariable

591Amostly conserved

621Cmostly conserved

624Amostly conserved

627Tmostly conserved

636Amostly conserved

ACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGATTATTAATTCGTGCTGAATTAGGAAATCCAGGATCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes4

BINs3

Most divergent pair5.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix pulvipennellasame genus2.4%Agonopterix multiplicellasame genus3.0%Agonopterix carduncellisame genus3.0%Agonopterix straminellasame genus3.1%Agonopterix kayseriensissame genus3.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type88 records

Wild obs. + sensor24

Museum / vouchered64

Range

Area of Occupancy AOO184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy52% within 1 km

≤100 m 8≤1 km 4≤10 km 8>10 km 3

23 georeferenced · 1 without coordinates

Open the mapobservation + sensor24

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤1 km 2>10 km 1

3 georeferenced · 61 without coordinates

Open the institutions mapphysical evidence64

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
North Carolina State University Insect Museumlocation not on record	21
University of Guelph, Centre for Biodiversity Genomicslocation not on record	9
Cleveland Museum of Natural History, OH (CLEV)location not on record	9
Mississippi State, US	4
Washington, US	4
Cambridge, US	1
St. Paul, US	1
East Lansing, US	1
Universidad Católica de Manizaleslocation not on record	1

9 institutions · 51 of 64 vouchered records shown · 13 without an institution code

09Environmental DNA32 detections

Where the DNA of Agonopterix eupatoriiella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found32

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 32 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.4. Temperate ForestForest4. Native Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.9 °C 6.80–22.4

Seasonal swing summer↔winter26.2 °C

Max temp (day)19.9 °C 11.8–27.7

Min temp (night)8.90 °C 3.70–17.4

Precipitation89.0 mm/mo 30.0–121

Air humidity55.5 % 52.5–59.5

Moisture balance-21.8 mm/mo -70.1–-2.10

Vapour deficit694 Pa 442–1,138

Wind speed3.50 m/s 2.30–4.30

Cloud cover41.9 % 32.6–46.5

CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)