Agnocoris rubicundus

(Fallen, 1807) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Miridae/Agnocoris

At a glance

Occurrence records1 376

Data sources7

Biological traits0

DNA specimens82

eDNA detections71

Sources7 archives

Databases and archives Agnocoris rubicundus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 376 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI71 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics82 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 376 records

Environmental DNA3 datasets · 7 countries71 detections

DNA & barcodingBOLD82 specimens

01Narrative

Agnocoris rubicundus is a species of plant bug in the family Miridae. It is found in Europe and Northern Asia (excluding China) and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding82 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agnocoris rubicundus has left across the world's sequence archives.

At a glance

DNA specimens82

BINs3

Marker genes2

eDNA detections71

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus75 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

25Avariable

58Cvariable

82Gvariable

94Cvariable

154Cvariable

181Avariable

199Avariable

334Avariable

337Cmostly conserved

361Cmostly conserved

370Gmostly conserved

394Tvariable

466Tmostly conserved

475Avariable

562Amostly conserved

583Avariable

586Cmostly conserved

622Gvariable

628Avariable

CTTATATTTTATTTTTGGAATATGAGCAGGAATATTAGGCACATCATTAAGATGAATCATTCGAATTGAATTAGGTATACCGGGATCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes11

BINs3

Most divergent pair2.6%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agnocoris utahensissame genus7.0%Agnocoris pulverulentussame genus7.6%Pinalitus rubricatussame family9.7%Cyphodemidea saundersisame family9.9%Lygus borealissame family10.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type1 376 records

Wild obs. + sensor762

Museum / vouchered576

Other38

Range

Area of Occupancy AOO2 972 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 301≤1 km 286≤10 km 129>10 km 18

734 georeferenced · 28 without coordinates

Open the mapobservation + sensor762

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 296≤1 km 108≤10 km 64>10 km 4

472 georeferenced · 104 without coordinates

Open the institutions mapphysical evidence576

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	182
Natural History Museum, Aarhus Denmarklocation not on record	52
NHMOlocation not on record	49
SLU Artdatabankenlocation not on record	27
Philadelphia, US	26
University of Guelph, Centre for Biodiversity Genomicslocation not on record	16
Champaign, US	6
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	5
Rovaniemi, FI	5
Mississippi State, US	3
Helsinki, FI	3
Forssa, FI	3
ZMAAlocation not on record	3
BioFokuslocation not on record	2
Jyväskylä, FI	2
neflocation not on record	2
Tallinn, EE	1
WGSlocation not on record	1
Metsähallituslocation not on record	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
Norwegian Institute of Bioeconomy Researchlocation not on record	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1

22 institutions · 392 of 576 vouchered records shown · 173 without an institution code

09Environmental DNA71 detections

Where the DNA of Agnocoris rubicundus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found71

Studies independent surveys3

Countries7

Verifiable raw sequence linked25

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 71 detections have coordinates

Open the map7 countries0

ForestUrban1030-1200, shoreline, under logs14. Artificial - Terrestrial | 14.5 Urban Ar…Wetland3. Shrubland | 3.3. Boreal Shrubland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.4 °C 6.00–18.2

Seasonal swing summer↔winter26.4 °C

Max temp (day)15.6 °C 9.00–23.2

Min temp (night)8.00 °C 0.2–14.0

Precipitation70.7 mm/mo 34.4–103

Air humidity57.2 % 53.1–64.1

Moisture balance-38.9 mm/mo -85.7–44.4

Vapour deficit592 Pa 346–950

Wind speed2.60 m/s 1.90–3.60

Cloud cover48.6 % 37.1–60.3

CHELSA 1981–2010, ~9 km grid, at location & month of 71 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agnocoris rubicundus

At a glance

Sources7 archives

At a glance

Record type1 376 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 376 records