Agnocoris pulverulentus

(Uhler, 1892) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Miridae/Agnocoris

At a glance

Occurrence records415

Data sources6

Biological traits0

DNA specimens29

eDNA detections29

Sources6 archives

Databases and archives Agnocoris pulverulentus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility415 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF415 records

Environmental DNA1 datasets · 2 countries29 detections

DNA & barcodingBOLD29 specimens

01Narrative

Agnocoris pulverulentus is a species of plant bug in the family Miridae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agnocoris pulverulentus has left across the world's sequence archives.

At a glance

DNA specimens29

BINs3

Marker genes1

eDNA detections29

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P633 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

123Cmostly conserved

147Tmostly conserved

168Tmostly conserved

177Tmostly conserved

186Gmostly conserved

225Tmostly conserved

228Tmostly conserved

267Cmostly conserved

363Amostly conserved

420Gmostly conserved

423Gmostly conserved

432Cmostly conserved

463Gmostly conserved

475Gmostly conserved

501Gmostly conserved

555Gmostly conserved

564Cmostly conserved

615Amostly conserved

621Amostly conserved

TTTATTTTTGGAATATGGGCAGGAATATTAGGCACATCACTAAGATGAATCATTCGAATCGAACTAGGTATACCTGGATCATTTATTGGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.67%

Haplotypes4

BINs3

Most divergent pair4.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agnocoris utahensissame genus3.9%Agnocoris rubicundussame genus7.6%Agnocoris reclaireisame genus7.6%Stenotus binotatussame family11.2%Pappus luridussame family11.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type415 records

Wild obs. + sensor3

Museum / vouchered412

Range

Area of Occupancy AOO204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 1

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤1 km 175≤10 km 53

228 georeferenced · 184 without coordinates

Open the institutions mapphysical evidence412

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	280
Champaign, US	69
College Station, US	26
University of Guelph, Centre for Biodiversity Genomicslocation not on record	16
CUlocation not on record	1
Provo, US	1
Cornell University Insect Collectionlocation not on record	1

7 institutions · 394 of 412 vouchered records shown · 18 without an institution code

09Environmental DNA29 detections

Where the DNA of Agnocoris pulverulentus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map2 countries0

Riparian Zone1. Forest & WoodlandWetlandMixed habitatForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.0 °C 15.6–22.1

Seasonal swing summer↔winter26.4 °C

Max temp (day)23.8 °C 20.0–27.2

Min temp (night)16.6 °C 12.0–19.9

Precipitation84.7 mm/mo 81.5–103

Air humidity57.9 % 57.1–58.9

Moisture balance-57.7 mm/mo -97.2–-16.3

Vapour deficit1,022 Pa 775–1,115

Wind speed2.90 m/s 2.10–6.10

Cloud cover39.5 % 38.5–42.1

CHELSA 1981–2010, ~9 km grid, at location & month of 29 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)