Aglaostigma fulvipes

(Scopoli, 1763) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Aglaostigma

At a glance

Occurrence records3 010

Data sources7

Biological traits0

DNA specimens87

eDNA detections89

Sources7 archives

Databases and archives Aglaostigma fulvipes's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 010 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI89 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics87 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 010 records

Environmental DNA4 datasets · 11 countries89 detections

DNA & barcodingBOLD87 specimens

01Narrative

Aglaostigma fulvipes is a Palearctic species of sawfly.Benson, R.B., 1952. Handbooks for the Identification of British Insects. Hymenoptera, Symphyta, Vol 6, Section 2(a-c), Royal Entomological Society, London

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding87 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aglaostigma fulvipes has left across the world's sequence archives.

At a glance

DNA specimens87

BINs4

Marker genes1

eDNA detections89

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P640 bp consensus59 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 55 variable positions, in barcode order

4Cmostly conserved

7Amostly conserved

16Cvariable

19Amostly conserved

49Cmostly conserved

64Avariable

73Amostly conserved

112Gvariable

127Cvariable

148Tmostly conserved

166Amostly conserved

169Amostly conserved

172Cvariable

182Cvariable

185Amostly conserved

187Tmostly conserved

202Amostly conserved

268Amostly conserved

269Cmostly conserved

272Avariable

295Cvariable

301Tvariable

307Gvariable

325Cmostly conserved

328Gvariable

331Cvariable

334Amostly conserved

337Amostly conserved

364Cvariable

379Tmostly conserved

400Amostly conserved

403Cmostly conserved

406Amostly conserved

418Amostly conserved

427Cmostly conserved

433Tmostly conserved

459Amostly conserved

469Tvariable

499Cvariable

505Tmostly conserved

518Cvariable

532Tvariable

535Cmostly conserved

542Cvariable

556Cvariable

583Amostly conserved

592Amostly conserved

595Tmostly conserved

601Cvariable

610Avariable

616Tmostly conserved

619Tmostly conserved

626Cmostly conserved

628Avariable

631Cmostly conserved

TTTCGGATTATGATCCGGAATATTAGGATTATCTTTTAGAATAATCATCCGAATAGAATTAGGAATACCAGGATCAATAATTGGAGATGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.9%

Haplotypes23

BINs4

Most divergent pair16.1%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aglaostigma aucupariaesame genus9.5%Aglaostigma alboplagiatumsame genus9.8%Aglaostigma lichtwardtisame genus10.6%Aglaostigma pinguesame genus11.0%Aglaostigma rubenssame genus11.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 010 records

Wild obs. + sensor2 534

Museum / vouchered476

Range

Area of Occupancy AOO6 728 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 908≤1 km 323≤10 km 1 065>10 km 7

2 303 georeferenced · 231 without coordinates

Open the mapobservation + sensor2 534

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 109≤1 km 113≤10 km 81>10 km 2

305 georeferenced · 171 without coordinates

Open the institutions mapphysical evidence476

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	106
NHMOlocation not on record	84
BioFokuslocation not on record	56
Oulu, FI	36
ZSMlocation not on record	22
Tilburg, NL	16
ZMAAlocation not on record	16
Philadelphia, US	13
SLU Artdatabankenlocation not on record	8
Bavarian State Collection of Zoologylocation not on record	8
Institute of Zoology Slovak Academy of Scienceslocation not on record	6
neflocation not on record	6
Natural History Museum Rotterdamlocation not on record	6
Muzeum Górnośląskie w Bytomiulocation not on record	3
University of Oululocation not on record	2
Stockholm, SE	2
Helsinki, FI	2
NEFlocation not on record	1
Bonn, DE	1
Natural History Museum, Londonlocation not on record	1
NCMGlocation not on record	1
Gothenburg, SE	1
MNHWlocation not on record	1
South Kensington, GB	1
Ghent, BE	1

25 institutions · 400 of 476 vouchered records shown · 76 without an institution code

09Environmental DNA89 detections

Where the DNA of Aglaostigma fulvipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found89

Studies independent surveys4

Countries11

Verifiable raw sequence linked12

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 89 detections have coordinates

Open the map11 countries0

14. Artificial - Terrestrial | 14.5 Urban Ar…black fallow areabutterfly meadow

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.4 °C 7.80–14.7

Seasonal swing summer↔winter19.0 °C

Max temp (day)16.3 °C 11.7–18.5

Min temp (night)7.50 °C 2.80–10.7

Precipitation70.8 mm/mo 44.3–108

Air humidity58.8 % 57.0–61.2

Moisture balance-35.3 mm/mo -57.9–4.00

Vapour deficit587 Pa 424–696

Wind speed3.00 m/s 2.20–4.80

Cloud cover40.0 % 33.5–52.8

CHELSA 1981–2010, ~9 km grid, at location & month of 86 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aglaostigma fulvipes

At a glance

Sources7 archives

At a glance

Record type3 010 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 010 records