Aglaostigma aucupariae

(Klug, 1817) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Aglaostigma

At a glance

Occurrence records4 310

Data sources9

Biological traits0

DNA specimens49

eDNA detections29

Sources9 archives

Databases and archives Aglaostigma aucupariae's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 310 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics49 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 310 records

Environmental DNA2 datasets · 7 countries29 detections

DNA & barcodingBOLD49 specimens

Genome at a glanceGoaT · TreeOfSex2n = 24

01Narrative

Aglaostigma aucupariae is a Palearctic species of sawfly.Benson, R.B., 1952. Handbooks for the Identification of British Insects. Hymenoptera, Symphyta, Vol 6, Section 2(a-c), Royal Entomological Society, London

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding49 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aglaostigma aucupariae has left across the world's sequence archives.

At a glance

DNA specimens49

BINs1

Marker genes1

eDNA detections29

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.48%

Haplotypes1

BIN1

Where individuals differ — all 5 variable positions, in barcode order

372Cvariable

538Avariable

564Avariable

627Gmostly conserved

633Cvariable

ACATTATATTTTATATTTGGATTATGATCAGGAATACTAGGTCTATCATTTAGAATAATCATTCGTATAGAATTAGGAATACCAGGGTCA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aglaostigma fulvipessame genus9.5%Aglaostigma alboplagiatumsame genus9.9%Aglaostigma rubenssame genus10.0%Aglaostigma lichtwardtisame genus10.0%Aglaostigma pinguesame genus10.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Aglaostigma aucupariae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Chromosome records12–242n range24median24mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 243×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Gokhman, V. E. "Karyotypes of parasitic Hymenoptera: evolution, systematic and phylogenetic implications." Unpublished D. Sc. thesis. Moscow: Moscow State University (2003). ↗

2n 121×GoaT · Tree of Sex Database

GoaT · Tree of Sex Database — ↗

08Occurrence & distribution

Record type4 310 records

Wild obs. + sensor3 960

Museum / vouchered350

Range

Area of Occupancy AOO9 176 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 1 857≤1 km 435≤10 km 1 316>10 km 25

3 633 georeferenced · 327 without coordinates

Open the mapobservation + sensor3 960

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 50≤1 km 91≤10 km 85>10 km 1

227 georeferenced · 123 without coordinates

Open the institutions mapphysical evidence350

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	92
Tilburg, NL	27
Oulu, FI	24
BioFokuslocation not on record	23
ZSMlocation not on record	21
Bavarian State Collection of Zoologylocation not on record	21
NHMOlocation not on record	18
ZMAAlocation not on record	17
Natural History Museum Rotterdamlocation not on record	12
Philadelphia, US	10
SLU Artdatabankenlocation not on record	8
Institute of Zoology Slovak Academy of Scienceslocation not on record	6
Stockholm, SE	4
Nijmegen, NL	3
Natural History Museum, Londonlocation not on record	3
neflocation not on record	3
South Kensington, GB	3
University of Oululocation not on record	2
NEFlocation not on record	1
Ghent, BE	1
Helsinki, FI	1
Muzeum Górnośląskie w Bytomiulocation not on record	1

22 institutions · 301 of 350 vouchered records shown · 49 without an institution code

09Environmental DNA29 detections

Where the DNA of Aglaostigma aucupariae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys2

Countries7

Verifiable raw sequence linked7

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.0 °C 8.40–14.3

Seasonal swing summer↔winter19.1 °C

Max temp (day)14.9 °C 12.3–17.8

Min temp (night)6.40 °C 3.20–10.7

Precipitation53.6 mm/mo 41.0–144

Air humidity58.8 % 56.7–61.1

Moisture balance-39.2 mm/mo -65.0–34.9

Vapour deficit564 Pa 433–688

Wind speed3.00 m/s 2.60–4.90

Cloud cover39.9 % 34.0–48.0

CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aglaostigma aucupariae

At a glance

Sources9 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 310 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 310 records