Aglaophenia pluma

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Cnidaria/Hydrozoa/Leptothecata/Aglaopheniidae/Aglaophenia

At a glance

Occurrence records3 560

Data sources9

Biological traits2

DNA specimens13

eDNA detections14

Sources9 archives

Databases and archives Aglaophenia pluma's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 085 records↗

OBISOcean Biodiversity Information System1 475 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionLOTUS5 compounds

Occurrence & distributionGBIF · OBIS3 560 records

Environmental DNA1 datasets · 2 countries14 detections

DNA & barcodingBOLD13 specimens

01Narrative

Aglaophenia pluma, the toothed feather hydroid or podded hydroid, is a colonial hydroid in the family Aglaopheniidae and is found worldwide. It lives from the shore to 120m under water.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

03Chemical composition5 compounds

Compounds documented for Aglaophenia pluma across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Carboline alkaloids3

Cholestane steroids $ Stigmastane steroids1

Cholestane steroids1

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
6,8-dibromo-1-ethyl-9H-pyrido[3,4-b]indole	present	LOTUS
6-bromo-1-ethyl-9H-pyrido[3,4-b]indole	present	LOTUS
6-Bromo-1-methyl-9H-pyrido(3,4-b)indole	present	LOTUS
Cholesterol	present	LOTUS
Stigmasterol	present	LOTUS

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aglaophenia pluma has left across the world's sequence archives.

At a glance

DNA specimens13

BINs2

Marker genes2

eDNA detections14

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P606 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 75% of positions are identical in every specimen.

Where individuals differ — all 153 variable positions, in barcode order

1Tmostly conserved

24Tmostly conserved

26Amostly conserved

56Tmostly conserved

104Amostly conserved

109Amostly conserved

110Tmostly conserved

114Tmostly conserved

179Cmostly conserved

193Cvariable

194Amostly conserved

197Gmostly conserved

206Tvariable

209Tmostly conserved

212Tmostly conserved

213Avariable

215Avariable

258Cmostly conserved

275Cmostly conserved

287Gvariable

302Amostly conserved

305Amostly conserved

314Cmostly conserved

368Cvariable

380Tmostly conserved

383Cmostly conserved

398Cmostly conserved

419Tmostly conserved

439Tmostly conserved

440Gmostly conserved

442Gmostly conserved

446Tmostly conserved

448Cmostly conserved

449Amostly conserved

452Gmostly conserved

462Gmostly conserved

465Amostly conserved

469Tmostly conserved

470Tvariable

471Cmostly conserved

474Tmostly conserved

476Amostly conserved

477Tmostly conserved

480Gmostly conserved

481Tmostly conserved

484Gmostly conserved

485Amostly conserved

486Tmostly conserved

487Cmostly conserved

488Tmostly conserved

489Gmostly conserved

490Tmostly conserved

491Avariable

492Tmostly conserved

494Amostly conserved

496Tmostly conserved

497Amostly conserved

499Cmostly conserved

500Amostly conserved

501Gmostly conserved

502Cmostly conserved

503Tmostly conserved

510Cvariable

511Tmostly conserved

512Amostly conserved

513Cvariable

514Tmostly conserved

515Amostly conserved

516Cmostly conserved

517Tmostly conserved

518Amostly conserved

519Tmostly conserved

522Tmostly conserved

524Amostly conserved

525Cmostly conserved

526Cmostly conserved

527Amostly conserved

528Gmostly conserved

529Tmostly conserved

530Tmostly conserved

531Tmostly conserved

532Tmostly conserved

533Amostly conserved

534Gmostly conserved

535Cmostly conserved

536Tmostly conserved

537Gmostly conserved

538Gmostly conserved

539Amostly conserved

540Gmostly conserved

541Cmostly conserved

542Tmostly conserved

543Amostly conserved

544Tmostly conserved

545Amostly conserved

546Amostly conserved

547Cmostly conserved

548Tmostly conserved

549Amostly conserved

550Tmostly conserved

551Gmostly conserved

552Cmostly conserved

553Tmostly conserved

554Amostly conserved

555Tmostly conserved

556Tmostly conserved

557Amostly conserved

558Amostly conserved

559Cmostly conserved

560Amostly conserved

561Gmostly conserved

562Amostly conserved

563Tmostly conserved

564Cmostly conserved

565Gmostly conserved

566Tmostly conserved

567Amostly conserved

568Amostly conserved

569Tmostly conserved

570Tmostly conserved

+33 more variable positions not shown

TTTCTGGTATGATAGGAACATCCTTAAGTATGTTAATAAGATTAGAACTAAATAATCCAGGACAAATGTTAGGAGACGGTCAAATGTATA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)8.0%

Haplotypes6

BINs2

Most divergent pair17.8%

OtherEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aglaophenia latirostrissame genus8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type3 560 records

Wild obs. + sensor1 658

Museum / vouchered1 410

Other492

Origin

Native150

Range

Area of Occupancy AOO4 412 km²

Depth

0–200 m sunlit848

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 14.3 m · max 108 m · 848 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 1 120≤1 km 212≤10 km 57>10 km 3

1 392 georeferenced · 266 without coordinates

Open the mapobservation + sensor1 658

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 15≤1 km 157≤10 km 14>10 km 26

212 georeferenced · 1 198 without coordinates

Open the institutions mapphysical evidence1 410

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brussels, BE	60
RBINS-Scientific Heritagelocation not on record	40
DASSHlocation not on record	12
Copenhagen, DK	8
South Kensington, GB	7
CEFASlocation not on record	7
NTNU-VMlocation not on record	7
Citadel Hill, GB	7
University of Oslo (UiO)location not on record	7
Natural History Museum Rotterdamlocation not on record	5
Stockholm, SE	5
PNHSlocation not on record	5
Washington, US	4
CASlocation not on record	4
Marine Biological Association of the UKlocation not on record	3
Tilburg, NL	2
Victoria, CA	2
National Marine Biodiversity Institute of Korealocation not on record	2
Santa Barbara Museum of Natural Historylocation not on record	1
UGentlocation not on record	1
WoRMS Editorial Boardlocation not on record	1
Cantablocation not on record	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1
Senckenberg Research Institute and Natural History Museumlocation not on record	1
Institut Francais pour l'Etude de la Merlocation not on record	1
Barcelona, ES	1
Cambridge, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1

28 institutions · 197 of 1 410 vouchered records shown · 41 without an institution code

09Environmental DNA14 detections

Where the DNA of Aglaophenia pluma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map2 countries0

amoung mix of ascidians, algae and Hydroids

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.8 °C 16.6–19.6

Seasonal swing summer↔winter7.10 °C

Max temp (day)18.4 °C 18.2–20.1

Min temp (night)17.2 °C 14.9–19.1

Precipitation81.5 mm/mo 34.6–87.1

Air humidity62.3 % 60.9–65.0

Vapour deficit776 Pa 660–893

Cloud cover47.0 % 35.2–57.1

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aglaophenia pluma

At a glance

Sources9 archives

Habitat & environment2

Compound class profile3 classes

Documented compounds5 total

At a glance

Record type3 560 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 560 records