Aglaophenia latirostris

Nutting, 1900 · species

image placeholder — illustration coming later

Animalia/Cnidaria/Hydrozoa/Leptothecata/Aglaopheniidae/Aglaophenia

At a glance

Occurrence records60

Data sources6

Biological traits2

DNA specimens4

eDNA detections0

Sources6 archives

Databases and archives Aglaophenia latirostris's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility43 records↗

OBISOcean Biodiversity Information System17 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS60 records

DNA & barcodingBOLD4 specimens

01Narrative

Aglaophenia latirostris is een hydroïdpoliep uit de familie Aglaopheniidae. De poliep komt uit het geslacht Aglaophenia. Aglaophenia latirostris werd in 1900 voor het eerst wetenschappelijk beschreven door Nutting.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aglaophenia latirostris has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P643 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.41%

Haplotypes1

BIN1

Where individuals differ — all 4 variable positions, in barcode order

321Gvariable

333Cvariable

462Gvariable

531Gvariable

TATTTAATATTTGGCTTATTTTCAGGTATGATAGGAACATCCTTAAGTATGTTAATAAGACTAGAATTAAATAATCCAGGACAAATGCTA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aglaophenia plumasame genus8.7%Macrorhynchia philippinasame family14.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type60 records

Wild obs. + sensor13

Museum / vouchered44

Other3

Range

Area of Occupancy AOO124 km²

Depth

0–200 m sunlit3

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 13 m · max 57.9 m · 3 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 11 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 6≤10 km 6

12 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence44

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	9
Santa Barbara Museum of Natural Historylocation not on record	7
Toronto, CA	4
Washington, US	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Victoria, CA	1
Royal British Columbia Museumlocation not on record	1

7 institutions · 29 of 44 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)