Ageniaspis citricola

Logvinovskaya, 1983 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Encyrtidae/Ageniaspis

At a glance

Occurrence records4

Data sources6

Biological traits0

DNA specimens10

eDNA detections10

Sources6 archives

Databases and archives Ageniaspis citricola's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 records

Environmental DNA1 datasets · 2 countries10 detections

DNA & barcodingBOLD10 specimens

01Narrative

Ageniaspis citricola is een vliesvleugelig insect uit de familie Encyrtidae. De wetenschappelijke naam is voor het eerst geldig gepubliceerd in 1983 door Logvinovskaya.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ageniaspis citricola has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes2

eDNA detections10

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P647 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

GTTATATTTTATTTTTGGTGCTTGAGCTGGTGTTTTAGGTCTATCCTTAAGAATACTTATTCGTATGGAGTTGGGTACTGCAGGTACCTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Omphale versicolorsame order15.6%Metaphycus anneckeisame family16.1%Metaphycus lounsburyisame family16.1%Aphelinus paramalisame order17.2%Aphelinus humilissame order17.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type4 records

Wild obs. + sensor4

Range

Area of Occupancy AOO8 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 1>10 km 3

4 georeferenced

Open the mapobservation + sensor4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA10 detections

Where the DNA of Ageniaspis citricola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…3. Shrubland | 3.5. Subtropical/Tropical Dry…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.7 °C 22.6–23.3

Seasonal swing summer↔winter4.90 °C

Max temp (day)23.0 °C 23.0–26.3

Min temp (night)22.4 °C 21.5–22.6

Precipitation59.1 mm/mo 59.1–157

Air humidity69.1 % 68.4–69.1

Moisture balance-93.2 mm/mo -93.2–19.8

Vapour deficit852 Pa 852–911

Wind speed3.20 m/s 2.00–3.20

Cloud cover42.6 % 42.6–58.1

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)