Ageneiosus pardalis

Lütken, 1874 · species

image placeholder — illustration coming later

Animalia/Chordata/Siluriformes/Auchenipteridae/Ageneiosus

At a glance

Occurrence records10 164

Data sources8

Biological traits5

DNA specimens50

eDNA detections41

Sources8 archives

Databases and archives Ageneiosus pardalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 164 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI41 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics50 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF10 164 records

Environmental DNA1 datasets · 1 countries41 detections

DNA & barcodingBOLD50 specimens

01Narrative

Ageneiosus pardalis is a species of driftwood catfish of the family Auchenipteridae. It can be found in the Maracaibo Lake.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length63 cm

Body mass972 g

Habitat & environment2

Habitat freshwateryes

Habitat zonepelagic

Other traits1

Vulnerability50.74

05DNA & barcoding50 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ageneiosus pardalis has left across the world's sequence archives.

At a glance

DNA specimens50

BINs4

Marker genes11

eDNA detections41

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P625 bp consensus40 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

24Cmostly conserved

30Amostly conserved

141Gvariable

172Amostly conserved

183Gmostly conserved

189Avariable

267Cvariable

315Cmostly conserved

402Gmostly conserved

427Amostly conserved

441Amostly conserved

480Gvariable

483Amostly conserved

489Tmostly conserved

511Tvariable

600Tvariable

GCAGGAATAGTCGGCACTGCCCTCAGCCTATTAATTCGAGCAGAATTAGCCCAACCAGGGGCCCTCTTGGGCGATGACCAAATTTATAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes6

BINs4

Most divergent pair2.7%

S.AmericaN.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tympanopleura rondonisame family9.5%Ageneiosus akamaisame genus10.0%Ageneiosus ucayalensissame genus10.1%Ageneiosus vittatussame genus10.1%Ageneiosus uranophthalmussame genus10.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_026717 ↗ · 13 protein · 22 tRNA · 2 rRNA

COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBND1ND212S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type10 164 records

Wild obs. + sensor9 986

Museum / vouchered178

Origin

Native7

Range

Area of Occupancy AOO856 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 2≤10 km 1

3 georeferenced · 9 983 without coordinates

Open the mapobservation + sensor9 986

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 30≤1 km 14≤10 km 17>10 km 6

67 georeferenced · 111 without coordinates

Open the institutions mapphysical evidence178

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	45
Universidad de Antioquia (UdeA)location not on record	35
University of Nebraskalocation not on record	19
Celsia Colombia S.A. E.S.P.(CELSIA)location not on record	17
Chicago, US	11
Universidad del Tolima (UT)location not on record	10
Universidad Tecnológica del Chocó (UTCH)location not on record	8
Universidad Católica de Oriente (UCO)location not on record	7
Instituto de Biodiversidad de Venezuela - INBIOlocation not on record	5
Pontificia Universidad Javeriana (PUJ)location not on record	4
Universidad El Bosque (El Bosque)location not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Washington, US	1
Toronto, CA	1
	1
Universidad Industrial de Santander (UIS)location not on record	1
Champaign, US	1

17 institutions · 168 of 178 vouchered records shown · 10 without an institution code

09Environmental DNA41 detections

Where the DNA of Ageneiosus pardalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found41

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 41 detections have coordinates

Open the map1 country0

Cuerpo de agua lenticoLoticCuerpo de agua lotico

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.4 °C 26.2–27.2

Seasonal swing summer↔winter1.40 °C

Max temp (day)29.2 °C 29.0–29.9

Min temp (night)23.4 °C 22.9–24.4

Precipitation289 mm/mo 162–360

Air humidity69.1 % 67.5–71.4

Moisture balance154 mm/mo 26.7–223

Vapour deficit1,069 Pa 976–1,179

Wind speed1.10 m/s 1.10–1.50

Cloud cover32.8 % 25.4–38.2

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ageneiosus pardalis

At a glance

Sources8 archives

Size & morphology2

Habitat & environment2

Other traits1

At a glance

Record type10 164 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type10 164 records