Ageneiosus vittatus

Steindachner, 1908 · species

image placeholder — illustration coming later

Animalia/Chordata/Siluriformes/Auchenipteridae/Ageneiosus

At a glance

Occurrence records63

Data sources6

Biological traits4

DNA specimens6

eDNA detections0

Sources6 archives

Databases and archives Ageneiosus vittatus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility63 records↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF63 records

DNA & barcodingBOLD6 specimens

01Narrative

Ageneiosus vittatus is a species of driftwood catfish of the family Auchenipteridae. It can be found in the Amazon basin and the Orinoco River.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length22 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonepelagic

Other traits1

Vulnerability16.84

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ageneiosus vittatus has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P613 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

201Avariable

274Cvariable

306Avariable

312Avariable

315Avariable

346Gmostly conserved

357Gvariable

453Gmostly conserved

600Tvariable

TTTGGTGCCTGGGCAGGAATAGTTGGTACTGCCCTCAGCCTGCTAATTCGAGCAGAGCTAGCCCAGCCAGGGGCCCTCCTAGGCGATGAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.76%

Haplotypes5

BIN1

Most divergent pair1.3%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ageneiosus inermissame genus6.9%Ageneiosus magoisame genus7.0%Ageneiosus militarissame genus7.3%Tympanopleura rondonisame family7.5%Tympanopleura longipinnasame family7.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type63 records

Museum / vouchered63

Origin

Native1

Range

Area of Occupancy AOO204 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3>10 km 3

6 georeferenced · 57 without coordinates

Open the institutions mapphysical evidence63

10Collections & institutions

Holding institutions6 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	10
Museu de Zoologia da Universidade de Sao Paulolocation not on record	7
Chicago, US	7
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	7
Washington, US	6
University of Nebraskalocation not on record	6
Texas Memorial Museum, Texas Natural History Collectionlocation not on record	4
Montgomery, US	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Toronto, CA	2
CIRA-UNANlocation not on record	1
Londrina, BR	1
Texas Cooperative Wildlife Collectionlocation not on record	1
USP-RPlocation not on record	1
Museo de Historia Natural “Gustavo Orcés V"location not on record	1

15 institutions · 58 of 63 vouchered records shown · 5 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)