Ageneiosus lineatus

Ribeiro, Rapp Py-Daniel & Walsh, 2017 · species

image placeholder — illustration coming later

Animalia/Chordata/Siluriformes/Auchenipteridae/Ageneiosus

At a glance

Occurrence records99

Data sources4

Biological traits5

DNA specimens32

eDNA detections32

Sources4 archives

Databases and archives Ageneiosus lineatus's data was compiled from.

GBIFGlobal Biodiversity Information Facility99 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF99 records

Environmental DNA1 datasets · 1 countries32 detections

DNA & barcodingBOLD32 specimens

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length16 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonepelagic

Other traits2

Depth min3 m

Vulnerability10

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ageneiosus lineatus has left across the world's sequence archives.

At a glance

DNA specimens32

BINs1

Marker genes1

eDNA detections32

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P613 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

18Gmostly conserved

78Tmostly conserved

162Cmostly conserved

243Tmostly conserved

294Gmostly conserved

357Amostly conserved

402Amostly conserved

411Tmostly conserved

562Tmostly conserved

TTCGGTGCCTGGGCAGGGATAGTTGGCACTGCCCTCAGCTTACTAATTCGAGCAGAATTAGCCCAACCAGGGGCTCTTCTGGGCGATGAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.32%

Haplotypes9

BIN1

Most divergent pair1.3%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tympanopleura longipinnasame family10.1%Ageneiosus polystictussame genus10.4%Ageneiosus inermissame genus10.4%Ageneiosus intrusussame genus10.4%Ageneiosus ucayalensissame genus10.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type99 records

Wild obs. + sensor1

Museum / vouchered98

Range

Area of Occupancy AOO256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 98 records without

Open the institutions mapphysical evidence98

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	20
PUC-RSlocation not on record	13
Chicago, US	9
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	7
Instituto de Biodiversidad de Venezuela - INBIOlocation not on record	5
UNICAMPlocation not on record	4
Museu de Zoologia da Universidade de Sao Paulolocation not on record	3
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	3
Museu Paraense Emílio Goeldilocation not on record	1
Champaign, US	1

10 institutions · 66 of 98 vouchered records shown · 32 without an institution code

09Environmental DNA32 detections

Where the DNA of Ageneiosus lineatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found32

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 32 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.6 °C 25.9–26.9

Seasonal swing summer↔winter1.20 °C

Max temp (day)30.1 °C 29.4–30.2

Min temp (night)23.4 °C 23.1–23.8

Precipitation73.7 mm/mo 66.2–233

Air humidity68.8 % 68.6–71.4

Moisture balance-63.6 mm/mo -72.6–101

Vapour deficit1,089 Pa 963–1,109

Wind speed1.40 m/s 0.9–1.60

Cloud cover40.3 % 37.8–64.0

CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)