Ageneiosus polystictus

Steindachner, 1915 · species

image placeholder — illustration coming later

Animalia/Chordata/Siluriformes/Auchenipteridae/Ageneiosus

At a glance

Occurrence records56

Data sources8

Biological traits4

DNA specimens9

eDNA detections7

Sources8 archives

Databases and archives Ageneiosus polystictus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility56 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF56 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD9 specimens

01Narrative

Ageneiosus polystictus is a species of driftwood catfish of the family Auchenipteridae. It can be found on the Amazon basin.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length45 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonepelagic

Other traits1

Vulnerability41.96

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ageneiosus polystictus has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P613 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 31 variable positions, in barcode order

3Cvariable

57Amostly conserved

66Amostly conserved

111Tmostly conserved

171Cmostly conserved

186Cmostly conserved

201Gmostly conserved

267Gmostly conserved

271Cmostly conserved

276Gmostly conserved

294Gmostly conserved

297Cmostly conserved

303Cmostly conserved

309Gmostly conserved

312Amostly conserved

345Gmostly conserved

348Cmostly conserved

351Tmostly conserved

357Amostly conserved

432Cmostly conserved

441Tmostly conserved

450Amostly conserved

453Amostly conserved

495Gmostly conserved

520Tmostly conserved

528Amostly conserved

555Cmostly conserved

565Tmostly conserved

579Cmostly conserved

585Tmostly conserved

606Cmostly conserved

TTCGGTGCCTGGGCAGGAATAGTTGGTACTGCCCTCAGCCTACTAATTCGAGCAGAATTAGCCCAACCAGGGGCCCTCCTAGGCGATGAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes3

BINs2

Most divergent pair5.1%

S.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ageneiosus inermissame genus4.9%Ageneiosus militarissame genus8.6%Tympanopleura rondonisame family8.6%Ageneiosus akamaisame genus8.8%Tympanopleura longipinnasame family9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type56 records

Museum / vouchered56

Range

Area of Occupancy AOO188 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 55 without coordinates

Open the institutions mapphysical evidence56

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	19
Museu de Zoologia da Universidade de Sao Paulolocation not on record	13
Instituto de Biodiversidad de Venezuela - INBIOlocation not on record	12
Museu Paraense Emílio Goeldilocation not on record	3
Londrina, BR	1
Toronto, CA	1
USP-RPlocation not on record	1

7 institutions · 50 of 56 vouchered records shown · 6 without an institution code

09Environmental DNA7 detections

Where the DNA of Ageneiosus polystictus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.2 °C 26.1–26.4

Seasonal swing summer↔winter1.60 °C

Max temp (day)29.7 °C 29.0–29.8

Min temp (night)23.2 °C 23.1–23.6

Precipitation161 mm/mo 128–191

Air humidity71.2 % 71.0–71.7

Moisture balance33.5 mm/mo -7.70–66.6

Vapour deficit983 Pa 956–993

Wind speed1.20 m/s 0.9–1.50

Cloud cover49.6 % 46.4–57.8

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)