Agelasa nigriceps

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Chrysomelidae/Agelasa

At a glance

Occurrence records1 006

Data sources4

Biological traits0

DNA specimens139

eDNA detections139

Sources4 archives

Databases and archives Agelasa nigriceps's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 006 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI139 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics139 specimens↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 006 records

Environmental DNA1 datasets · 1 countries139 detections

DNA & barcodingBOLD139 specimens

01Narrative

Agelasa nigriceps is a species of skeletonizing leaf beetle in the family Chrysomelidae, found in the Palearctic. Its most common host plant is Actinidia arguta, although the beetles have been evolving in Japan to use Pterostyrax hispidus as a host plant.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding139 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agelasa nigriceps has left across the world's sequence archives.

At a glance

DNA specimens139

BINs1

Marker genes1

eDNA detections139

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P417 bp consensus138 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 47 variable positions, in barcode order

12Amostly conserved

15Amostly conserved

24Cmostly conserved

30Amostly conserved

46Tmostly conserved

48Avariable

49Amostly conserved

52Amostly conserved

54Amostly conserved

60Tmostly conserved

69Gvariable

72Avariable

77Cmostly conserved

78Amostly conserved

81Avariable

93Tvariable

99Tvariable

105Avariable

108Cmostly conserved

150Tmostly conserved

159Gvariable

160Cmostly conserved

168Avariable

171Avariable

174Gmostly conserved

192Gvariable

201Tmostly conserved

219Tmostly conserved

237Avariable

243Avariable

244Tmostly conserved

249Cmostly conserved

258Amostly conserved

259Cmostly conserved

267Tmostly conserved

270Amostly conserved

307Tmostly conserved

309Amostly conserved

315Tvariable

336Avariable

337Cmostly conserved

378Cvariable

381Amostly conserved

384Amostly conserved

387Gvariable

390Avariable

417Tmostly conserved

TTAAATAACATAAGATTTTGACTCCTCCCACCTTCTTTATTTTTATTAATTATAAGAAGTATCGTAGAGAGAGGTGCAGGAACAGGATGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 110 variants.

Diversity (π)4.4%

Haplotypes109

BIN1

Most divergent pair8.2%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Crepidodera sculpturatasame family15.8%Anthophylax viridissame order16.5%Trichophoromyia ubiquitalissame order17.3%Aleochara lustricasame order17.5%Stethopachys formosasame family17.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 006 records

Wild obs. + sensor651

Museum / vouchered355

Range

Area of Occupancy AOO2 116 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 57≤1 km 60≤10 km 30>10 km 11

158 georeferenced · 493 without coordinates

Open the mapobservation + sensor651

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 10

10 georeferenced · 345 without coordinates

Open the institutions mapphysical evidence355

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NSMKlocation not on record	101
Chiba, JP	26
Sagamihara, JP	18
Sanda, JP	15
Iwate Prefectural Museumlocation not on record	13
HUNMlocation not on record	10
Department of Microbiology, Prince of Songkla Universitylocation not on record	10
Obihiro Centennial City Museumlocation not on record	6
Yamaguchi-shi, JP	6
Tomioka, JP	5
DRIBlocation not on record	4
KCMNlocation not on record	3
RCMlocation not on record	2
MJINlocation not on record	2
Toyama, JP	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
Teylers Museumlocation not on record	1
Bando, JP	1
Toyota city nature sanctuarylocation not on record	1

19 institutions · 226 of 355 vouchered records shown

09Environmental DNA139 detections

Where the DNA of Agelasa nigriceps was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found139

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 139 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C 7.40–7.40

Seasonal swing summer↔winter25.4 °C

Max temp (day)9.60 °C

Min temp (night)3.00 °C

Precipitation344 mm/mo

Air humidity64.9 %

Moisture balance263 mm/mo

Vapour deficit428 Pa

Wind speed2.90 m/s

Cloud cover44.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 135 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agelasa nigriceps

At a glance

Sources4 archives

At a glance

Record type1 006 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 006 records