Agdistis satanas

Millière, 1875 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pterophoridae/Agdistis

At a glance

Occurrence records25

Data sources8

Biological traits0

DNA specimens16

eDNA detections16

Sources8 archives

Databases and archives Agdistis satanas's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility25 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF25 records

Environmental DNA1 datasets · 6 countries16 detections

DNA & barcodingBOLD16 specimens

01Narrative

Agdistis satanas is a moth in the family Pterophoridae. It is known from the Balearic Islands, Portugal, Spain, France, Corsica, Italy (Piedmont, Val d’Aosta, Latium, Apulia, Sardinia, Sicily), Malta, Germany, Albania, Romania, Bulgaria, Greece, Crete, Turkey, Israel, Algeria, Tunisia, Libya and Morocco. The wingspan is about 20 mm. Adults are on wing from April to September. The larvae feed on Scabiosa candicans, Scabiosa pyrenaica, Scleranthus species and Limoniastrum monopetalum.Contribution to the Knowledge of the Pterophoridae from Pantano Longarini (South-Eastern Sicily)

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agdistis satanas has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections16

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

10Cvariable

31Cmostly conserved

43Tmostly conserved

79Amostly conserved

101Gmostly conserved

115Cmostly conserved

178Cmostly conserved

187Cvariable

202Cmostly conserved

238Cmostly conserved

268Gvariable

304Tvariable

364Tvariable

514Amostly conserved

523Tmostly conserved

530Gmostly conserved

542Tmostly conserved

571Cmostly conserved

622Tmostly conserved

AACCTTATACTTTATTTTTGGAATTTGAGCCGGAATATTAGGTACTTCTTTAAGTATATTAATTCGAGCCGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.69%

Haplotypes6

BIN1

Most divergent pair1.4%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agdistis nigrasame genus6.7%Agdistis criocephalasame genus7.6%Agdistis variisame genus7.6%Agdistis heydenisame genus7.9%Agdistis adactylasame genus8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type25 records

Wild obs. + sensor20

Museum / vouchered5

Origin

Native2

Range

Area of Occupancy AOO80 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 3≤1 km 11≤10 km 6

20 georeferenced

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA16 detections

Where the DNA of Agdistis satanas was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map6 countries0

dry coastal meadow

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 17.1–23.4

Seasonal swing summer↔winter15.5 °C

Max temp (day)22.8 °C 20.0–28.1

Min temp (night)16.1 °C 11.6–18.3

Precipitation37.4 mm/mo 25.9–43.9

Air humidity56.8 % 51.8–62.2

Moisture balance-108 mm/mo

Vapour deficit989 Pa 740–1,325

Wind speed3.20 m/s

Cloud cover37.3 % 29.3–41.8

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)