Agdistis adactyla

(Hübner, 1819) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pterophoridae/Agdistis

At a glance

Occurrence records173

Data sources6

Biological traits0

DNA specimens23

eDNA detections12

Sources6 archives

Databases and archives Agdistis adactyla's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility173 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF173 records

Environmental DNA1 datasets · 4 countries12 detections

DNA & barcodingBOLD23 specimens

01Narrative

Agdistis adactyla is a moth in the family Pterophoridae. It is known from most of the Palearctic realm, from central and south-western Europe to eastern Asia.A new species, a new synonym, and new distribution records in the genus Agdistis Hübner, 1825 from Iran (Pterophoridae: Agdistinae) Records including China (Beijing, Tianjin, Hebei, Inner Mongolia, Shaanxi, Gansu, Ningxia, Xinjiang), Mongolia, Afghanistan, Pakistan, Iran and Turkey. The wingspan is 22–26 mm. The forewings are dark grey with four dark spots along the costa. The hindwings are also grey with a cream colored fringe. Adults are on wing from June to mid August.microlepidoptera.nl The larvae feed on Artemisia campestris and Chenopodium fruticosum. They live in the lower parts of the plant. Larvae can be found from September to following year May.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agdistis adactyla has left across the world's sequence archives.

At a glance

DNA specimens23

BINs5

Marker genes1

eDNA detections12

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 55 variable positions, in barcode order

5Tmostly conserved

16Tmostly conserved

28Avariable

43Tmostly conserved

79Tmostly conserved

82Cmostly conserved

100Amostly conserved

103Tmostly conserved

142Cvariable

169Tvariable

181Amostly conserved

206Tmostly conserved

220Tmostly conserved

232Amostly conserved

238Tmostly conserved

274Cmostly conserved

287Tvariable

292Tvariable

337Tvariable

340Tvariable

343Avariable

346Cvariable

364Tmostly conserved

382Amostly conserved

397Tvariable

400Tmostly conserved

412Amostly conserved

424Tmostly conserved

428Cmostly conserved

430Amostly conserved

433Avariable

439Tmostly conserved

451Cvariable

454Cvariable

478Cvariable

484Avariable

494Tmostly conserved

499Cmostly conserved

500Tmostly conserved

505Tmostly conserved

517Tvariable

526Tvariable

530Gmostly conserved

562Tvariable

568Tmostly conserved

574Avariable

589Tmostly conserved

607Tvariable

610Cmostly conserved

613Tmostly conserved

628Amostly conserved

631Amostly conserved

634Tmostly conserved

637Tmostly conserved

646Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGTACTTCTTTAAGTATATTAATTCGTGCTGAATTAGGTAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.4%

Haplotypes10

BINs5

Most divergent pair7.8%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agdistis heydenisame genus6.2%Agdistis nigrasame genus6.5%Agdistis janseisame genus7.3%Agdistis prisonersame genus7.3%Agdistis variisame genus7.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type173 records

Wild obs. + sensor76

Museum / vouchered96

Other1

Range

Area of Occupancy AOO404 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy43% within 1 km

≤100 m 13≤1 km 15≤10 km 32>10 km 5

65 georeferenced · 11 without coordinates

Open the mapobservation + sensor76

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 3≤1 km 32≤10 km 2

37 georeferenced · 59 without coordinates

Open the institutions mapphysical evidence96

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	21
Tartu, EE	20
Nijmegen, NL	13
European Distributed Institute of Taxonomy (EDIT)location not on record	11
Provincia di Livornolocation not on record	8
Salzburg, AT	1
ZSMlocation not on record	1
University of Kaiserslauternlocation not on record	1
Tallinn, EE	1
DanishLepidopterologicalSocietylocation not on record	1

10 institutions · 78 of 96 vouchered records shown · 18 without an institution code

09Environmental DNA12 detections

Where the DNA of Agdistis adactyla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.9 °C 8.20–19.0

Seasonal swing summer↔winter19.6 °C

Max temp (day)18.8 °C 13.0–23.5

Min temp (night)9.50 °C 1.80–14.2

Precipitation86.9 mm/mo 64.4–154

Air humidity57.9 % 55.4–59.6

Moisture balance-37.9 mm/mo -74.6–39.5

Vapour deficit711 Pa 494–928

Wind speed2.30 m/s 2.20–4.20

Cloud cover37.0 % 32.2–37.7

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)