Agdistis meridionalis

(Zeller, 1847) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pterophoridae/Agdistis

At a glance

Occurrence records99

Data sources8

Biological traits2

DNA specimens14

eDNA detections15

Sources8 archives

Databases and archives Agdistis meridionalis's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility99 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF99 records

Environmental DNA1 datasets · 4 countries15 detections

DNA & barcodingBOLD14 specimens

01Narrative

Agdistis meridionalis, the sea-side plume, is a moth of the family Pterophoridae, first described by the German entomologist Philipp Christoph Zeller in 1847. It is found in Europe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agdistis meridionalis has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections15

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

4Tmostly conserved

10Cmostly conserved

187Tmostly conserved

193Tmostly conserved

197Cmostly conserved

235Tmostly conserved

238Tmostly conserved

268Avariable

274Tmostly conserved

287Cvariable

301Tmostly conserved

407Tmostly conserved

470Tmostly conserved

490Cmostly conserved

646Tmostly conserved

TACTTTATACTTTATTTTCGGAATTTGAGCAGGAATATTAGGAACATCCTTAAGTATATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.63%

Haplotypes6

BIN1

Most divergent pair1.8%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agdistis bennetiisame genus6.5%Thalatha bryochlorasame order9.0%Bryophila seladonasame order9.1%Rhesala fusiformissame order9.3%Hypermaepha latericolorsame order9.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type99 records

Wild obs. + sensor94

Museum / vouchered5

Origin

Native3

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy27% within 1 km

≤100 m 10≤1 km 14≤10 km 59>10 km 6

89 georeferenced · 5 without coordinates

Open the mapobservation + sensor94

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	1

1 institutions · 1 of 5 vouchered records shown · 4 without an institution code

09Environmental DNA15 detections

Where the DNA of Agdistis meridionalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 17.2–25.4

Seasonal swing summer↔winter13.3 °C

Max temp (day)24.2 °C 18.0–26.2

Min temp (night)17.2 °C 14.9–24.7

Precipitation14.6 mm/mo 1.90–72.4

Air humidity60.6 % 55.4–65.5

Vapour deficit1,011 Pa 769–1,277

Cloud cover35.6 % 20.3–40.1

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)