Agdistis bennetii

(Curtis, 1833) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pterophoridae/Agdistis

At a glance

Occurrence records578

Data sources8

Biological traits2

DNA specimens3

eDNA detections4

Sources8 archives

Databases and archives Agdistis bennetii's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility578 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF578 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD3 specimens

01Narrative

Agdistis bennetii is a moth of the family Pterophoridae found in Europe. It inhabits salt marshes. Figs.1 larva after final moult, 1a pupa

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agdistis bennetii has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections4

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

79Avariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACTTCTTTAAGTATATTAATTCGAGCAGAATTAGGAAATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agdistis meridionalissame genus6.5%Lesmone porciasame order8.5%Metalectra discalissame order8.7%Philedonides rhombicanasame order8.8%Actinotia intermediatasame order8.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type578 records

Wild obs. + sensor539

Museum / vouchered39

Origin

Native1

Range

Area of Occupancy AOO676 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy10% within 1 km

≤100 m 28≤1 km 27≤10 km 468>10 km 5

528 georeferenced · 11 without coordinates

Open the mapobservation + sensor539

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 9≤1 km 4≤10 km 9

22 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence39

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	14
Durban Natural Science Museumlocation not on record	8
Nijmegen, NL	7
South Kensington, GB	4
Natural History Museum Rotterdamlocation not on record	3
Natural History Museum, Londonlocation not on record	2
MZLUlocation not on record	1

7 institutions · 39 of 39 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Agdistis bennetii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 14.1–17.7

Seasonal swing summer↔winter15.1 °C

Max temp (day)18.4 °C 15.4–21.4

Min temp (night)12.9 °C 12.7–13.0

Precipitation58.7 mm/mo 56.9–60.5

Air humidity62.4 % 61.2–63.5

Moisture balance-71.4 mm/mo -82.5–-60.3

Vapour deficit692 Pa 593–790

Wind speed4.20 m/s 3.80–4.60

Cloud cover40.7 % 38.8–42.6

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)