Agdistis frankeniae

(Zeller, 1847) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pterophoridae/Agdistis

At a glance

Occurrence records35

Data sources8

Biological traits0

DNA specimens12

eDNA detections2

Sources8 archives

Databases and archives Agdistis frankeniae's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility35 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF35 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD12 specimens

01Narrative

Agdistis frankeniae is a moth in the family Pterophoridae. It is found from Siberia through Central Asia, the northern parts of Asia and North Africa along the Mediterranean and in the west from the Canary Islands to southern France.A new species, a new synonym, and new distribution records in the genus Agdistis Hübner, 1825 from Iran (Pterophoridae: Agdistinae) The wingspan is about 29 mm. The larvae feed on Limonium minutum and Frankenia species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agdistis frankeniae has left across the world's sequence archives.

At a glance

DNA specimens12

BINs4

Marker genes1

eDNA detections2

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Where individuals differ — all 97 variable positions, in barcode order

10Cvariable

22Avariable

34Avariable

38Tmostly conserved

40Amostly conserved

49Avariable

67Amostly conserved

70Tmostly conserved

85Cmostly conserved

100Amostly conserved

103Tmostly conserved

121Tmostly conserved

127Tvariable

133Cvariable

142Cvariable

190Amostly conserved

197Cmostly conserved

199Tmostly conserved

202Cvariable

205Avariable

206Tmostly conserved

232Avariable

238Cmostly conserved

241Tmostly conserved

256Tmostly conserved

266Tmostly conserved

268Amostly conserved

271Avariable

274Tmostly conserved

277Cvariable

287Cvariable

307Amostly conserved

319Tmostly conserved

322Tmostly conserved

328Amostly conserved

334Avariable

340Tmostly conserved

346Tmostly conserved

347Cmostly conserved

349Tvariable

352Tmostly conserved

355Tmostly conserved

359Cvariable

364Tmostly conserved

367Cvariable

379Tmostly conserved

385Cvariable

386Tmostly conserved

391Amostly conserved

397Cmostly conserved

400Cmostly conserved

403Tmostly conserved

407Cvariable

412Avariable

421Tmostly conserved

424Amostly conserved

433Tmostly conserved

436Tmostly conserved

442Cvariable

451Cmostly conserved

454Tmostly conserved

460Cvariable

467Avariable

468Avariable

470Tmostly conserved

472Amostly conserved

484Avariable

499Tmostly conserved

500Tmostly conserved

502Amostly conserved

505Tmostly conserved

517Tvariable

520Tmostly conserved

532Amostly conserved

536Tmostly conserved

541Tmostly conserved

542Tmostly conserved

544Amostly conserved

547Tmostly conserved

562Avariable

568Cmostly conserved

583Tmostly conserved

586Amostly conserved

592Amostly conserved

596Tmostly conserved

604Avariable

607Tvariable

613Tmostly conserved

619Tmostly conserved

622Tmostly conserved

625Tmostly conserved

631Amostly conserved

637Amostly conserved

641Cmostly conserved

643Tmostly conserved

646Tvariable

652Cvariable

AACATTATACTTTATTTTTGGAATTTGATCAGGAATATTAGGAACTTCATTAAGTATATTAATTCGAGCTGAATTAGGAAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)6.6%

Haplotypes3

BINs4

Most divergent pair11.9%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agdistis manicatasame genus5.8%Agdistis bennetiisame genus10.6%Cyana quentinisame order11.5%Cyana smithisame order11.8%Euros osticollissame order11.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type35 records

Wild obs. + sensor25

Museum / vouchered10

Range

Area of Occupancy AOO76 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 8≤1 km 16

24 georeferenced · 1 without coordinates

Open the mapobservation + sensor25

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 1

4 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
DABUHlocation not on record	3

1 institutions · 3 of 10 vouchered records shown · 7 without an institution code

09Environmental DNA2 detections

Where the DNA of Agdistis frankeniae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.8 °C 23.8–23.8

Seasonal swing summer↔winter13.3 °C

Max temp (day)24.4 °C

Min temp (night)23.2 °C

Precipitation1.70 mm/mo

Air humidity65.5 %

Vapour deficit1,011 Pa

Cloud cover23.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)