Agapostemon nasutus

Smith, 1853 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Halictidae/Agapostemon

At a glance

Occurrence records2 694

Data sources7

Biological traits0

DNA specimens9

eDNA detections5

Sources7 archives

Databases and archives Agapostemon nasutus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 694 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 694 records

Environmental DNA1 datasets · 3 countries5 detections

DNA & barcodingBOLD9 specimens

01Narrative

Agapostemon nasutus is a species of sweat bee in the family Halictidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agapostemon nasutus has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes1

eDNA detections5

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)1.3%

Haplotypes2

BINs2

Most divergent pair3.8%

Where individuals differ — all 25 variable positions, in barcode order

31Amostly conserved

65Cmostly conserved

139Tmostly conserved

184Amostly conserved

232Cmostly conserved

250Tmostly conserved

256Cmostly conserved

259Tmostly conserved

265Tmostly conserved

271Tmostly conserved

313Amostly conserved

319Tmostly conserved

328Cmostly conserved

349Tmostly conserved

367Tmostly conserved

388Tmostly conserved

475Cmostly conserved

548Cmostly conserved

557Tmostly conserved

583Amostly conserved

595Cmostly conserved

613Tmostly conserved

616Tmostly conserved

622Tmostly conserved

646Cmostly conserved

AATATTATATTTTATTTTTGCCATATGATCAGGAATAATTGGATCATCTTTAAGTATATTAATTCGAATAGAATTAAGAAATCCAAGAAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agapostemon poeyisame genus13.1%Lasioglossum wilsonisame family13.5%Lasioglossum tannaensesame family13.5%Lasioglossum versifronssame family14.0%Lasioglossum hadrandrumsame family14.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 694 records

Wild obs. + sensor111

Museum / vouchered2 474

Other109

Range

Area of Occupancy AOO1 568 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 55≤1 km 16≤10 km 4>10 km 1

76 georeferenced · 35 without coordinates

Open the mapobservation + sensor111

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 605≤1 km 95≤10 km 333>10 km 34

1 067 georeferenced · 1 407 without coordinates

Open the institutions mapphysical evidence2 474

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mérida, MX	421
Beltsville, US	401
Tapachula, MX	343
Wuzhou, CN	334
Essig Museum of Entomologylocation not on record	252
ECOSUR-SClocation not on record	193
	153
Ciudad de México, MX	130
Mexico City, MX	109
Cambridge, US	46
National Biodiversity Institute, Costa Ricalocation not on record	32
Chicago, US	22
Champaign, US	10
OSUClocation not on record	5
Instituto Nacional de Biodiversidad, Costa Ricalocation not on record	3
North Carolina State University Insect Museumlocation not on record	3
New Haven, US	2
Instituto de Fitosanidad, Colegio de Postgraduados, Campus Montecillolocation not on record	2
Cape Town, ZA	2
University of Alabamalocation not on record	2
Universidad Nacional de Colombia (UNAL)location not on record	2

21 institutions · 2 467 of 2 474 vouchered records shown · 7 without an institution code

09Environmental DNA5 detections

Where the DNA of Agapostemon nasutus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map3 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.7 °C 21.7–26.3

Seasonal swing summer↔winter2.70 °C

Max temp (day)29.1 °C 24.7–29.6

Min temp (night)20.2 °C 17.9–22.4

Precipitation334 mm/mo 147–372

Air humidity64.3 % 62.5–66.5

Moisture balance162 mm/mo 26.9–228

Vapour deficit1,059 Pa 895–1,258

Wind speed1.20 m/s 1.00–2.90

Cloud cover30.9 % 21.5–31.4

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agapostemon nasutus

At a glance

Sources7 archives

At a glance

Record type2 694 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 694 records