Agalma okenii

Eschscholtz, 1825 · species

image placeholder — illustration coming later

Animalia/Cnidaria/Hydrozoa/Siphonophorae/Agalmatidae/Agalma

At a glance

Occurrence records1 135

Data sources7

Biological traits4

DNA specimens16

eDNA detections23

Sources7 archives

Databases and archives Agalma okenii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility556 records↗

OBISOcean Biodiversity Information System579 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS1 135 records

Environmental DNA3 datasets · 2 countries23 detections

DNA & barcodingBOLD16 specimens

01Narrative

Agalma okenii is een hydroïdpoliep uit de familie Agalmatidae. De poliep komt uit het geslacht Agalma. Agalma okenii werd in 1825 voor het eerst wetenschappelijk beschreven door Eschscholtz.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic

Other traits2

Depth max1 000 m

Depth min0 m

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agalma okenii has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections23

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P616 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

13Gmostly conserved

118Cmostly conserved

124Avariable

133Amostly conserved

157Cmostly conserved

181Amostly conserved

247Cmostly conserved

355Cvariable

364Amostly conserved

373Amostly conserved

394Tmostly conserved

412Tmostly conserved

460Tvariable

472Tmostly conserved

482Tmostly conserved

493Amostly conserved

496Amostly conserved

532Tmostly conserved

541Gmostly conserved

574Gmostly conserved

AACTTTATACTTGATTTTTGGTTTGTTTTCAGCAATGGTAGGTACAGCTTTAAGTATGATAATACGTTTAGAACTAGCAGGACCAGGTAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.84%

Haplotypes7

BIN1

Most divergent pair1.6%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agalma eleganssame genus11.4%Athorybia rosaceasame family14.4%Nanomia carasame family15.3%Nanomia bijugasame family16.6%Bargmannia elongatasame order16.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_080955 ↗ · 12 protein · 2 tRNA · 2 rRNA

COX2ATP6COX3ND2ND5ND6ND3ND4LND1ND4CYTBCOX116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type1 135 records

Wild obs. + sensor495

Museum / vouchered519

Other121

Range

Area of Occupancy AOO2 404 km²

Depth

0–200 m sunlit234

200–1000 m twilight167

1–4 km midnight35

>4 km abyssal3

median 164.5 m · max 5 397.5 m · 439 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 21≤1 km 111≤10 km 14

146 georeferenced · 349 without coordinates

Open the mapobservation + sensor495

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 43≤1 km 163≤10 km 1>10 km 50

257 georeferenced · 262 without coordinates

Open the institutions mapphysical evidence519

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	171
Washington, US	84
Tapachula, MX	34
Ciudad de México, MX	16
	14
Okinawa Institute for Science and Technologylocation not on record	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
IPMAlocation not on record	3
FCMMlocation not on record	1
Unidad Multidisciplinaria de Docencia e Investigación, Campus Sisal, Facultad de Ciencias, Universidad Nacional Autónoma de Méxicolocation not on record	1
UM-RSMASlocation not on record	1
Santa Barbara Museum of Natural Historylocation not on record	1
No Voucherlocation not on record	1
National Marine Biodiversity Institute of Korealocation not on record	1
University of California San Diegolocation not on record	1

15 institutions · 336 of 519 vouchered records shown · 58 without an institution code

09Environmental DNA23 detections

Where the DNA of Agalma okenii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys3

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map2 countries0

Atlantic Ocean

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.4 °C 21.7–26.4

Seasonal swing summer↔winter1.60 °C

Max temp (day)27.2 °C 22.5–27.3

Min temp (night)25.5 °C 20.8–25.6

Precipitation366 mm/mo 73.7–613

Air humidity65.7 % 61.0–65.8

Vapour deficit1,174 Pa 983–1,253

Cloud cover59.0 % 34.9–65.5

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agalma okenii

At a glance

Sources7 archives

Habitat & environment2

Other traits2

At a glance

Record type1 135 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 135 records