Agalma elegans

(Sars, 1846) · species

image placeholder — illustration coming later

Animalia/Cnidaria/Hydrozoa/Siphonophorae/Agalmatidae/Agalma

At a glance

Occurrence records778

Data sources9

Biological traits4

DNA specimens38

eDNA detections316

Sources9 archives

Databases and archives Agalma elegans's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility353 records↗

OBISOcean Biodiversity Information System425 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI316 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~3.48 Gbp↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS778 records

Environmental DNA6 datasets · 5 countries316 detections

DNA & barcodingBOLD38 specimens

Genome at a glanceGoaT3.5 Gbp

01Narrative

Agalma elegans is a species of siphonophores in the family Agalmatidae. It has been found in a wide variety of locations, including between the Reloncavi Fjord and the Boca del Guafo Passage, in the Chiloe Inland Sea (CIS), Chile.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic

Other traits2

Depth max200 m

Depth min0 m

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agalma elegans has left across the world's sequence archives.

At a glance

DNA specimens38

BINs2

Marker genes5

eDNA detections316

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P645 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 57 variable positions, in barcode order

1Amostly conserved

2Amostly conserved

3Cmostly conserved

4Tmostly conserved

6Tmostly conserved

7Amostly conserved

9Amostly conserved

10Tmostly conserved

11Tmostly conserved

13Amostly conserved

14Amostly conserved

17Tmostly conserved

18Tmostly conserved

20Gmostly conserved

21Gmostly conserved

22Tmostly conserved

23Tmostly conserved

25Amostly conserved

27Tmostly conserved

28Tmostly conserved

29Tmostly conserved

31Amostly conserved

32Gmostly conserved

33Cmostly conserved

34Tmostly conserved

35Amostly conserved

37Gmostly conserved

39Tmostly conserved

40Amostly conserved

41Gmostly conserved

42Gmostly conserved

65Cmostly conserved

67Tmostly conserved

68Tmostly conserved

73Amostly conserved

91Tmostly conserved

95Cmostly conserved

136Tmostly conserved

196Gmostly conserved

214Cmostly conserved

217Amostly conserved

223Amostly conserved

251Tmostly conserved

287Tmostly conserved

295Gmostly conserved

355Gvariable

364Tmostly conserved

370Cvariable

379Avariable

433Amostly conserved

508Amostly conserved

553Cmostly conserved

556Amostly conserved

565Amostly conserved

586Amostly conserved

601Tmostly conserved

613Cvariable

AACTTTATATTTAATTTTTGGTTTATTTTCAGCTATGGTAGGTACAGCTTTAAGTATGATTATACGTTTAGAATTAGCAGGTCCTGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.3%

Haplotypes13

BINs2

Most divergent pair1.9%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agalma okeniisame genus11.4%Parateclaia norvegicasame order12.9%Halopsis ocellatasame order13.8%Obelia dichotomasame order13.8%Eirene ceylonensissame order14.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S18S18S-5P28S

animal barcoderibosomalmarker

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_080954 ↗ · 12 protein · 2 tRNA · 2 rRNA

COX2ATP6COX3ND2ND5ND6ND3ND4LND1ND4CYTBCOX116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT

The complete instruction manual Agalma elegans carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size3 481 680 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Agalma elegans3.48 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type778 records

Wild obs. + sensor268

Museum / vouchered354

Other156

Range

Area of Occupancy AOO1 372 km²

Depth

0–200 m sunlit276

200–1000 m twilight58

1–4 km midnight14

>4 km abyssal0

median 84.9 m · max 3 948.8 m · 348 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy49% within 1 km

≤100 m 33≤1 km 13≤10 km 46>10 km 2

94 georeferenced · 174 without coordinates

Open the mapobservation + sensor268

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 29≤1 km 21>10 km 27

77 georeferenced · 277 without coordinates

Open the institutions mapphysical evidence354

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
IPMAlocation not on record	34
South Kensington, GB	28
Ciudad de México, MX	21
Tapachula, MX	10
Washington, US	9
Okinawa Institute for Science and Technologylocation not on record	8
Cambridge, US	4
JODClocation not on record	4
University Museum of Bergen, Natural History Collectionslocation not on record	2
Museo de Zoología de la Universidad de Concepción (UCCC_MZUC)location not on record	1
Citadel Hill, GB	1
Instituto de Investigaciones Marinas y Costeras (INVEMAR)location not on record	1
DASSHlocation not on record	1
	1

14 institutions · 125 of 354 vouchered records shown · 58 without an institution code

09Environmental DNA316 detections

Where the DNA of Agalma elegans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found316

Studies independent surveys6

Countries5

Verifiable raw sequence linked275

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 316 detections have coordinates

Open the map5 countries0

Atlantic OceanPacific Ocean

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.60 °C -5.30–17.4

Seasonal swing summer↔winter23.4 °C

Max temp (day)12.2 °C -1.40–21.1

Min temp (night)7.20 °C -8.90–15.5

Precipitation110 mm/mo 89.3–130

Air humidity61.5 % 60.3–65.0

Moisture balance56.7 mm/mo -31.0–179

Vapour deficit450 Pa 165–689

Wind speed4.90 m/s 1.80–6.20

Cloud cover51.9 % 45.7–64.5

CHELSA 1981–2010, ~9 km grid, at location & month of 305 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)