Afroceto africana

(Simon, 1910) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Trachelidae/Afroceto

At a glance

Occurrence records7

Data sources7

Biological traits28

DNA specimens20

eDNA detections26

Sources7 archives

Databases and archives Afroceto africana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

World Spider Trait DBMasaryk University28 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources28 traits

Occurrence & distributionGBIF7 records

Environmental DNA1 datasets · 1 countries26 detections

DNA & barcodingBOLD20 specimens

01Narrative

Afroceto africana est une espèce d'araignées aranéomorphes de la famille des Trachelidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesLyle & Haddad 2010

Morphometry28

Abdomen length♀2.25·♂1.9 mm

Body length♀4.23·♂3.66 mm

Cephalothorax length♀1.98·♂1.76 mm

Cephalothorax width♀1.7·♂1.45 mm

Femur I length♀2.4·♂3 mm

Femur II length♀2.2·♂2.6 mm

Femur III length♀1.53·♂1.7 mm

Femur IV length♀2.28·♂2.4 mm

Leg I length♀8.21·♂10.3 mm

Leg II length♀7.74·♂9.01 mm

Leg III length♀5.54·♂6.01 mm

Leg IV length♀7.96·♂8.61 mm

Metatarsus I length♀1.55·♂1.8 mm

Metatarsus II length♀1.48·♂1.65 mm

Metatarsus III length♀1.4·♂1.58 mm

Metatarsus IV length♀2.15·♂2.3 mm

Patella I length♀1.13·♂1.5 mm

Patella II length♀1.18·♂1.35 mm

Patella III length♀0.9·♂1.05 mm

Patella IV length♀1.03·♂1.15 mm

Tarsus I length♀1.15·♂1.3 mm

Tarsus II length♀1.18·♂1.08 mm

Tarsus III length♀0.58·♂0.58 mm

Tarsus IV length♀0.65·♂0.73 mm

Tibia I length♀1.88·♂2.7 mm

Tibia II length♀1.7·♂2.33 mm

Tibia III length♀1.13·♂1.1 mm

Tibia IV length♀1.85·♂2.03 mm

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Afroceto africana has left across the world's sequence archives.

At a glance

DNA specimens20

BINs1

Marker genes1

eDNA detections26

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

25Gmostly conserved

76Avariable

97Amostly conserved

169Amostly conserved

199Amostly conserved

262Gmostly conserved

263Tmostly conserved

310Gmostly conserved

352Gmostly conserved

538Amostly conserved

547Gmostly conserved

559Gmostly conserved

562Avariable

616Tvariable

TACTTTATATTTAATTTTTGGATCGTGATCTGCAATAGTTGGTACGGCTATGAGAGTAATAATTCGTATAGAATTAGGACAATCTGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.83%

Haplotypes11

BIN1

Most divergent pair2.1%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Meriola setosasame family11.1%Sillus dubiussame order11.6%Patelloceto secutorsame family12.0%Fuchibotulus kigeliasame family12.3%Agroeca pratensissame order13.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type7 records

Wild obs. + sensor1

Museum / vouchered6

Range

Area of Occupancy AOO28 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the institutions mapphysical evidence6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
NCAlocation not on record	3
NMBA, NCAlocation not on record	1
NCA, NMBAlocation not on record	1
Transvaal Museumlocation not on record	1

4 institutions · 6 of 6 vouchered records shown

09Environmental DNA26 detections

Where the DNA of Afroceto africana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found26

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 26 detections have coordinates

Open the map1 country0

Hillside4. Native Grassland | 4.5. Subtropical/Tropi…Grassland, hillside southern slopeOpen plain, grassland and thicket

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.8 °C 15.0–23.4

Seasonal swing summer↔winter14.4 °C

Max temp (day)28.5 °C 21.8–30.6

Min temp (night)15.2 °C 9.30–15.8

Precipitation46.9 mm/mo 6.40–82.1

Air humidity51.7 % 46.5–55.3

Moisture balance-123 mm/mo -194–-58.9

Vapour deficit1,219 Pa 826–1,534

Wind speed3.50 m/s 2.70–4.40

Cloud cover21.0 % 14.6–30.1

CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)