Aetobatus flagellum

(Bloch & Schneider, 1801) · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Myliobatiformes/Myliobatidae/Aetobatus

At a glance

Occurrence records46

Data sources9

Biological traits11

DNA specimens15

eDNA detections12

Sources9 archives

Databases and archives Aetobatus flagellum's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility24 records↗

OBISOcean Biodiversity Information System22 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources11 traits

Occurrence & distributionGBIF · OBIS46 records

Environmental DNA1 datasets · 2 countries12 detections

DNA & barcodingBOLD15 specimens

01Narrative

The longheaded eagle ray (Aetobatus flagellum) is a species of eagle ray in the family Myliobatidae. The longheaded eagle ray, like other members of the genus Aetobatus, is characteristically different from other genera of eagle rays, distinguished by their notched nasal curtain; complete, singular set of upper and lower teeth; and v-shaped teeth in the lower jaw. It is found in the tropical and warm temperate Indo-West Pacific. It formerly included populations in the northwest Pacific, but these were recognized as a separate species, Aetobatus narutobiei, in 2013.White, W.T.; Furmitsu, K.; Yamaguchi, A. (2013). "A New Species of Eagle Ray Aetobatus narutobiei from the Northwest Pacific: An Example of the Critical Role Taxonomy Plays in Fisheries and Ecological Sciences". PLOS ONE. 8 (12): e83785. doi:10.1371/journal.pone.0083785 Longheaded eagle rays are benthopelagic fishes that feed on crustaceans, cephalopods, echinoderms, and small bony fishes. It is a poorly known species, but generally uncommon and considered endangered by the IUCN.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAnAgeFishBase

Size & morphology2

Body length72 cm

Body mass7 645 g

⚠ sources differ — AnAge: 7 645 g · FishBase: 13 930 g

Life cycle & reproduction3

Age at sexual maturity2 190 days

Litter size3.5

Max. longevity192 months

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importanceminor commercial

Other traits2

Interbirth interval365 days

Vulnerability85.13

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aetobatus flagellum has left across the world's sequence archives.

At a glance

DNA specimens15

BINs3

Marker genes1

eDNA detections12

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 74 variable positions, in barcode order

4Tmostly conserved

8Cmostly conserved

43Cmostly conserved

52Cmostly conserved

53Tmostly conserved

67Gmostly conserved

70Gmostly conserved

92Tmostly conserved

97Cmostly conserved

103Tmostly conserved

118Gmostly conserved

136Avariable

139Cmostly conserved

142Gmostly conserved

157Gmostly conserved

160Tmostly conserved

163Gmostly conserved

166Avariable

178Cvariable

181Amostly conserved

193Amostly conserved

196Cmostly conserved

214Tmostly conserved

217Cmostly conserved

226Amostly conserved

229Cmostly conserved

256Cmostly conserved

262Cmostly conserved

263Tmostly conserved

277Cmostly conserved

280Tmostly conserved

281Tmostly conserved

295Amostly conserved

316Tmostly conserved

319Amostly conserved

337Tmostly conserved

340Tmostly conserved

349Tmostly conserved

355Cmostly conserved

358Amostly conserved

385Amostly conserved

388Cmostly conserved

397Cmostly conserved

398Cmostly conserved

406Gmostly conserved

415Cmostly conserved

436Tmostly conserved

439Tvariable

445Tmostly conserved

454Tmostly conserved

475Tvariable

478Tmostly conserved

484Amostly conserved

499Amostly conserved

505Amostly conserved

511Cmostly conserved

514Cmostly conserved

523Cmostly conserved

529Cmostly conserved

538Cmostly conserved

541Tmostly conserved

550Gvariable

562Gvariable

577Tmostly conserved

589Amostly conserved

610Cmostly conserved

616Amostly conserved

619Amostly conserved

622Gvariable

634Cmostly conserved

640Tmostly conserved

643Cmostly conserved

649Cvariable

650Tmostly conserved

CCTTTATCTAATCTTTGGTGCATGAGCAGGAATAGTGGGCACCGGTCTTAGCTTATTAATCCGGACGGAGTTAAGCCAGCCCGGGGCCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.4%

Haplotypes3

BINs3

Most divergent pair10.9%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aetobatus narinarisame genus13.3%Aetobatus ocellatussame genus13.8%Trygonoptera personatasame order16.7%Bathytoshia brevicaudatasame order17.2%Gymnura marmoratasame order17.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_022837 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBs-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type46 records

Wild obs. + sensor20

Museum / vouchered25

Other1

Origin

Native2

Range

Area of Occupancy AOO112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 9>10 km 4

13 georeferenced · 7 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 7≤10 km 3

10 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	5
CASlocation not on record	1
MNHAHlocation not on record	1
Louisiana State University, Museum of Zoologylocation not on record	1
Texas Cooperative Wildlife Collectionlocation not on record	1

5 institutions · 9 of 25 vouchered records shown · 1 without an institution code

09Environmental DNA12 detections

Where the DNA of Aetobatus flagellum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.2 °C 25.5–29.3

Seasonal swing summer↔winter1.20 °C

Max temp (day)29.7 °C 29.7–32.1

Min temp (night)24.4 °C 20.2–26.9

Precipitation188 mm/mo 5.40–188

Air humidity65.6 % 42.6–65.6

Moisture balance42.2 mm/mo

Vapour deficit1,237 Pa 1,237–2,244

Wind speed1.30 m/s

Cloud cover53.9 % 18.7–53.9

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)