Aethes moribundana

(Staudinger, 1859) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Aethes

At a glance

Occurrence records115

Data sources8

Biological traits0

DNA specimens10

eDNA detections6

Sources8 archives

Databases and archives Aethes moribundana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility115 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF115 records

Environmental DNA1 datasets · 3 countries6 detections

DNA & barcodingBOLD10 specimens

01Narrative

Aethes moribundana is a species of moth of the family Tortricidae. It was described by Staudinger in 1859. It is found in southern and eastern Europe, Algeria, Asia Minor, Iran, Afghanistan, Central Asia, MongoliaAethes at funet and China (Hebei, Inner Mongolia, Qinghai, Xinjiang).A Brief Summary of Tribe Cochylini from China (Lepidoptera: Tortricidae: Tortricinae) The wingspan is 15 –. Adults are on wing in May and from July to August. The larvae feed on Sideritis taurica.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aethes moribundana has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes1

eDNA detections6

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 37 variable positions, in barcode order

27Avariable

34Cmostly conserved

42Tmostly conserved

45Cvariable

88Cvariable

96Amostly conserved

102Cvariable

153Tvariable

159Gvariable

216Cvariable

231Tmostly conserved

252Cvariable

262Cvariable

267Cvariable

276Cvariable

300Tmostly conserved

309Cvariable

324Avariable

333Gvariable

336Cvariable

351Tmostly conserved

357Cvariable

360Tvariable

366Avariable

396Tvariable

417Tvariable

465Amostly conserved

486Cvariable

504Tmostly conserved

546Gvariable

561Tvariable

564Cvariable

612Tvariable

624Gvariable

637Cvariable

642Tmostly conserved

648Cvariable

TTATATTTTATTTTTGGTATTTGAGCAGGTATACTAGGAACTTCCTTAAGATTATTAATTCGAGCTGAATTAGGTAATCCAGGATCACTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes9

BINs2

Most divergent pair4.6%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aethes kyrkiisame genus6.8%Aethes rubiganasame genus7.1%Aethes scalanasame genus7.2%Aethes deutschianasame genus7.4%Aethes cnicanasame genus7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type115 records

Wild obs. + sensor62

Museum / vouchered53

Origin

Native1

Range

Area of Occupancy AOO248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 10≤1 km 26≤10 km 5>10 km 1

42 georeferenced · 20 without coordinates

Open the mapobservation + sensor62

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 52 without coordinates

Open the institutions mapphysical evidence53

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	43
ZAF-UMUlocation not on record	1

2 institutions · 44 of 53 vouchered records shown · 9 without an institution code

09Environmental DNA6 detections

Where the DNA of Aethes moribundana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.3 °C 16.9–20.5

Seasonal swing summer↔winter19.1 °C

Max temp (day)23.7 °C 20.9–24.9

Min temp (night)12.7 °C 12.0–14.6

Precipitation61.4 mm/mo 53.4–89.5

Air humidity55.0 % 54.1–58.8

Moisture balance-86.0 mm/mo -109–-79.7

Vapour deficit1,031 Pa 789–1,085

Wind speed4.00 m/s 1.50–4.50

Cloud cover35.0 % 34.0–36.1

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)