Aethes hartmanniana

(Clerck, 1759) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Aethes

At a glance

Occurrence records3 506

Data sources8

Biological traits2

DNA specimens67

eDNA detections71

Sources8 archives

Databases and archives Aethes hartmanniana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 506 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI71 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics67 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 506 records

Environmental DNA3 datasets · 9 countries71 detections

DNA & barcodingBOLD67 specimens

01Narrative

Aethes hartmanniana, the scabious conch, is a moth of the family Tortricidae. It was described by Carl Alexander Clerck in 1759. It is found in most of Europe, Asia Minor, Armenia and the southern Urals. The species occurs in chalky and limestone habitats. The wingspan is 15 –.Microlepidoptera.nl Adults are on wing from June to August. The larvae feed on Scabiosa ochroleuca, Succisa and Knautia species. They feed within the roots of their host plant.Hantsmoths The species overwinters and pupates in the larval habitation during spring.Lepidoptera of Belgium

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding67 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aethes hartmanniana has left across the world's sequence archives.

At a glance

DNA specimens67

BINs2

Marker genes1

eDNA detections71

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus57 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

19Cvariable

101Gmostly conserved

106Cvariable

115Tmostly conserved

118Tmostly conserved

172Tvariable

184Amostly conserved

266Cmostly conserved

286Amostly conserved

287Cmostly conserved

367Cmostly conserved

373Amostly conserved

451Cmostly conserved

460Tmostly conserved

466Gmostly conserved

490Cvariable

529Cmostly conserved

547Tmostly conserved

562Amostly conserved

577Amostly conserved

601Tmostly conserved

616Tvariable

628Avariable

643Amostly conserved

AACATTATATTTTATTTTCGGTATTTGAGCAGGTATAATTGGAACTTCTTTAAGATTACTAATTCGAGCTGAATTAGGTAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes18

BINs2

Most divergent pair3.5%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aethes caucasicasame genus5.6%Aethes nefandanasame genus6.1%Aethes tesseranasame genus6.5%Aethes kyrkiisame genus7.3%Aethes kasyisame genus7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 506 records

Wild obs. + sensor2 449

Museum / vouchered864

Other193

Range

Area of Occupancy AOO6 132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 1 092≤1 km 648≤10 km 322>10 km 21

2 083 georeferenced · 366 without coordinates

Open the mapobservation + sensor2 449

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 108≤1 km 373≤10 km 107

588 georeferenced · 276 without coordinates

Open the institutions mapphysical evidence864

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	172
Tartu, EE	115
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	106
DanishLepidopterologicalSocietylocation not on record	71
Kuopio, FI	58
SLU Artdatabankenlocation not on record	51
Philadelphia, US	38
Salzburg, AT	33
Stockholm, SE	33
NHMOlocation not on record	28
Rovaniemi, FI	17
ZSMlocation not on record	13
Nijmegen, NL	11
DABUHlocation not on record	7
Bavarian State Collection of Zoologylocation not on record	7
European Distributed Institute of Taxonomy (EDIT)location not on record	6
Muzeum Górnośląskie w Bytomiulocation not on record	5
Natural History Museum Rotterdamlocation not on record	5
Uniwersytet Łódzkilocation not on record	5
University of Kaiserslauternlocation not on record	3
Helsinki, FI	3
Tallinn, EE	3
Zürich, CH	3
Research Collection of Alfred Haslbergerlocation not on record	3
Research Collection of Theo Gruenewaldlocation not on record	2
neflocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1

27 institutions · 800 of 864 vouchered records shown · 64 without an institution code

09Environmental DNA71 detections

Where the DNA of Aethes hartmanniana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found71

Studies independent surveys3

Countries9

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 71 detections have coordinates

Open the map9 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 7.60–19.0

Seasonal swing summer↔winter19.3 °C

Max temp (day)18.4 °C 12.0–23.1

Min temp (night)8.90 °C 1.60–13.9

Precipitation96.5 mm/mo 61.2–309

Air humidity60.0 % 57.9–65.3

Moisture balance-29.1 mm/mo -53.7–180

Vapour deficit659 Pa 360–908

Wind speed3.10 m/s 1.70–4.00

Cloud cover37.3 % 31.6–40.8

CHELSA 1981–2010, ~9 km grid, at location & month of 66 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aethes hartmanniana

At a glance

Sources8 archives

Diet & foraging2

At a glance

Record type3 506 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 506 records