Aethes flagellana

(Duponchel, 1836) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Aethes

At a glance

Occurrence records119

Data sources7

Biological traits0

DNA specimens6

eDNA detections0

Sources7 archives

Databases and archives Aethes flagellana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility119 records↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF119 records

DNA & barcodingBOLD6 specimens

01Narrative

Aethes flagellana is a species of moth of the family Tortricidae. It is found on Corsica, Sardinia, Sicily and Crete and in the Netherlands, France, Spain, Italy, Germany, Austria, Switzerland, the Czech Republic, Slovakia, Slovenia, Poland, Albania, Hungary, Bulgaria, Romania, North Macedonia, Greece, Lithuania, Ukraine, Russia and Asia Minor, Lebanon, Iran and the Kopet Dagh mountains.Aethes at funet The wingspan is 15 –. Adults are on wing in March and from June to July. The larvae feed on Eryngium campestre. Larvae can be found from August to May.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aethes flagellana has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.50%

Haplotypes2

BIN1

Most divergent pair0.92%

Where individuals differ — all 7 variable positions, in barcode order

101Cmostly conserved

119Cmostly conserved

230Cmostly conserved

285Cmostly conserved

344Gmostly conserved

356Tvariable

497Cvariable

CATTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACTTCTTTAAGACTTTTAATTCGAGCTGAATTAGGAAATCCAGGATCAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aethes kasyisame genus1.8%Aethes beatricellasame genus4.7%Aethes fennicanasame genus4.7%Aethes francillanasame genus4.9%Aethes rubiginanasame genus5.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type119 records

Wild obs. + sensor82

Museum / vouchered32

Other5

Origin

Native2

Range

Area of Occupancy AOO296 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy34% within 1 km

≤100 m 14≤1 km 7≤10 km 41

62 georeferenced · 20 without coordinates

Open the mapobservation + sensor82

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence32

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Nijmegen, NL	10
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	10
University of Kaiserslauternlocation not on record	3
ZAF-UMUlocation not on record	2
Provincia di Livornolocation not on record	1
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1

7 institutions · 28 of 32 vouchered records shown · 4 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)