Aethalura intertexta

(Walker, 1860) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Aethalura

At a glance

Occurrence records2 370

Data sources8

Biological traits0

DNA specimens99

eDNA detections100

Sources8 archives

Databases and archives Aethalura intertexta's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 370 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI100 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics99 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 370 records

Environmental DNA1 datasets · 2 countries100 detections

DNA & barcodingBOLD99 specimens

01Narrative

Aethalura intertexta, the four-barred gray or smoky carpet moth, is a moth in the family Geometridae. The species was first described by Francis Walker in 1860. It is found in North America. The MONA or Hodges number for Aethalura intertexta is 6570. Aethalura intertexta, adultes Exemplar

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding99 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aethalura intertexta has left across the world's sequence archives.

At a glance

DNA specimens99

BINs2

Marker genes2

eDNA detections100

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus91 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 42 variable positions, in barcode order

19Cmostly conserved

50Cvariable

59Cmostly conserved

76Amostly conserved

81Gvariable

82Cvariable

91Amostly conserved

94Amostly conserved

100Amostly conserved

106Tmostly conserved

115Cmostly conserved

127Gmostly conserved

142Cmostly conserved

157Tmostly conserved

181Gvariable

212Tmostly conserved

214Amostly conserved

235Cmostly conserved

247Cmostly conserved

250Tmostly conserved

268Amostly conserved

271Cmostly conserved

274Cmostly conserved

304Tmostly conserved

313Cvariable

352Tmostly conserved

400Tmostly conserved

403Gmostly conserved

433Gvariable

478Tmostly conserved

479Cmostly conserved

484Cmostly conserved

508Avariable

518Gmostly conserved

542Tmostly conserved

578Cmostly conserved

586Tmostly conserved

616Tmostly conserved

628Amostly conserved

631Amostly conserved

640Tmostly conserved

652Tmostly conserved

AACATTATATTTTATTTTCGGAATTTGAGCAGGAATAGTAGGAACTTCTCTAAGTTTACTAATTCGAGCAGAATTAGGTAGCCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes35

BINs2

Most divergent pair6.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aethalura punctulatasame genus4.9%Parapheromia configuratasame family7.1%Tephronia mosessame family7.9%Synegia camptogrammariasame family8.2%Mericisca graceasame family8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type2 370 records

Wild obs. + sensor1 968

Museum / vouchered402

Range

Area of Occupancy AOO3 356 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 1 174≤1 km 148≤10 km 62>10 km 114

1 498 georeferenced · 470 without coordinates

Open the mapobservation + sensor1 968

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 2≤1 km 58≤10 km 154>10 km 21

235 georeferenced · 167 without coordinates

Open the institutions mapphysical evidence402

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	124
Cambridge, US	58
University of Alberta Museums (UAM)location not on record	49
East Lansing, US	42
ASUlocation not on record	22
University of Guelph, Centre for Biodiversity Genomicslocation not on record	19
North Carolina State University Insect Museumlocation not on record	13
St. Paul, US	5
Cornell University Insect Collectionlocation not on record	4
SOVTlocation not on record	3
Centre for Biodiversity Genomicslocation not on record	3
Royal Saskatchewan Museumlocation not on record	3
Cleveland Museum of Natural History, OH (CLEV)location not on record	3
Vernal, US	2
Washington, US	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
OSUClocation not on record	1

17 institutions · 353 of 402 vouchered records shown · 49 without an institution code

09Environmental DNA100 detections

Where the DNA of Aethalura intertexta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found100

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 100 detections have coordinates

Open the map2 countries0

Temperate mixed forest1. Forest & Woodland|1.1. Boreal ForestBeachForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 6.80–19.4

Seasonal swing summer↔winter26.1 °C

Max temp (day)19.5 °C 11.8–23.9

Min temp (night)9.70 °C 1.80–15.8

Precipitation91.2 mm/mo 67.0–127

Air humidity57.0 % 54.6–61.7

Moisture balance-32.5 mm/mo -61.2–13.2

Vapour deficit692 Pa 448–910

Wind speed3.30 m/s 2.20–5.00

Cloud cover41.5 % 38.6–48.5

CHELSA 1981–2010, ~9 km grid, at location & month of 93 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aethalura intertexta

At a glance

Sources8 archives

At a glance

Record type2 370 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 370 records