Aeshna viridis

Eversmann, 1836 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Odonata/Aeshnidae/Aeshna

At a glance

Occurrence records11 713

Data sources9

Biological traits0

DNA specimens14

eDNA detections10

Sources9 archives

Databases and archives Aeshna viridis's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility11 713 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF11 713 records

Environmental DNA1 datasets · 3 countries10 detections

DNA & barcodingBOLD14 specimens

Genome at a glanceGoaT · NCBI≈1.7 Gbp

01Narrative

Aeshna viridis, the green hawker, is a species of dragonfly in the family Aeshnidae. It is found in Austria, the Czech Republic, Denmark, Estonia, Finland, Germany, Hungary, Latvia, Lithuania, the Netherlands, Poland, Russia, Serbia and Montenegro, Slovakia, Sweden, and Ukraine. Its natural habitats are rivers, swamps, lakes, and marshes. It is threatened by habitat loss in parts of its range but in general it is not very vulnerable.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aeshna viridis has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes3

eDNA detections10

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.14%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 4 variable positions, in barcode order

37Gmostly conserved

196Amostly conserved

407Tmostly conserved

481Amostly conserved

AACACTTTATTTTTTATTTGGGGCATGATCAGGAATGGTAGGAACTGCTCTAAGAGTTTTAATTCGAATTGAATTAGGACAACCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aeshna grandissame genus3.0%Aeshna serratasame genus3.6%Aeshna eremitasame genus5.5%Aeshna verticalissame genus5.8%Aeshna interruptasame genus5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS116S

animal barcodefungal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aeshna viridis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 695 113 831 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aeshna viridis1.7 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Chromosome records26–282n range27median28mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 261×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

2n 271×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

2n 281×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type11 713 records

Wild obs. + sensor11 436

Museum / vouchered277

Range

Area of Occupancy AOO4 128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy20% within 1 km

≤100 m 1 521≤1 km 626≤10 km 8 528>10 km 26

10 701 georeferenced · 735 without coordinates

Open the mapobservation + sensor11 436

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 67≤1 km 25≤10 km 66>10 km 34

192 georeferenced · 85 without coordinates

Open the institutions mapphysical evidence277

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	59
DanishLepidopterologicalSocietylocation not on record	50
Uniwersytet w Białymstokulocation not on record	49
SLU Artdatabankenlocation not on record	44
MZLUlocation not on record	21
Philadelphia, US	17
Tartu, EE	6
Muzeum Górnośląskie w Bytomiulocation not on record	6
Montréal, CA	3
Copenhagen, DK	2
Cambridge, US	1
BioFokuslocation not on record	1
Bonn, DE	1
Jyväskylä, FI	1
ZMAAlocation not on record	1

15 institutions · 262 of 277 vouchered records shown · 15 without an institution code

09Environmental DNA10 detections

Where the DNA of Aeshna viridis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.30 °C 3.00–17.5

Seasonal swing summer↔winter16.4 °C

Max temp (day)11.9 °C 5.20–20.9

Min temp (night)4.60 °C 0.5–14.0

Precipitation80.2 mm/mo 58.1–85.1

Air humidity64.0 % 60.6–68.5

Moisture balance-4.10 mm/mo -47.3–45.7

Vapour deficit449 Pa 241–790

Wind speed4.20 m/s 3.70–6.20

Cloud cover43.1 % 39.5–53.0

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aeshna viridis

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type11 713 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type11 713 records