Aeshna verticalis

Hagen, 1861 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Odonata/Aeshnidae/Aeshna

At a glance

Occurrence records1 760

Data sources10

Biological traits0

DNA specimens10

eDNA detections10

Sources10 archives

Databases and archives Aeshna verticalis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 760 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 760 records

Environmental DNA1 datasets · 2 countries10 detections

DNA & barcodingBOLD10 specimens

Genome at a glanceGoaT · TreeOfSex1.6 Gbp

01Narrative

Aeshna verticalis, the green-striped darner, is a species of dragonfly in the family Aeshnidae. It is typically found in northeastern United States and southern Ontario, Quebec, and New Brunswick. The green-striped darner has an IUCN conservation status of "Least Concern" with a stable population.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aeshna verticalis has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections10

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 36 variable positions, in barcode order

13Tmostly conserved

50Tmostly conserved

59Cmostly conserved

100Amostly conserved

133Amostly conserved

187Cmostly conserved

190Gmostly conserved

193Tmostly conserved

196Gmostly conserved

220Amostly conserved

229Amostly conserved

241Tmostly conserved

266Tmostly conserved

278Tmostly conserved

284Tmostly conserved

301Cmostly conserved

304Gmostly conserved

316Gmostly conserved

325Amostly conserved

334Tmostly conserved

346Cmostly conserved

352Tmostly conserved

370Amostly conserved

397Tmostly conserved

401Tmostly conserved

409Gmostly conserved

490Tmostly conserved

502Tmostly conserved

514Tmostly conserved

517Tmostly conserved

520Amostly conserved

526Amostly conserved

568Amostly conserved

574Tmostly conserved

595Tmostly conserved

652Cmostly conserved

AACACTTTATTTTTTATTTGGAGCATGATCAGGAATAGTAGGAACTGCTTTAAGAGTTCTAATTCGAATTGAATTAGGACAACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes3

BIN1

Most divergent pair5.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aeshna canadensissame genus2.1%Aeshna clepsydrasame genus2.5%Aeshna eremitasame genus3.6%Aeshna serratasame genus4.1%Aeshna grandissame genus4.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Aeshna verticalis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 555 020 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aeshna verticalis1.56 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Chromosome records28–282n range28median28mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 283×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Kiauta B (1972) Synopsis of the main cytotaxonomic data in the order Odonata. Odonatologica 1: 73-102. ↗

2n 272×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

08Occurrence & distribution

Record type1 760 records

Wild obs. + sensor1 265

Museum / vouchered495

Range

Area of Occupancy AOO4 664 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 339≤1 km 86≤10 km 16>10 km 439

880 georeferenced · 385 without coordinates

Open the mapobservation + sensor1 265

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 43≤1 km 41≤10 km 54>10 km 14

152 georeferenced · 343 without coordinates

Open the institutions mapphysical evidence495

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Odonata Centrallocation not on record	102
Saint John, CA	59
Toronto, CA	55
University Park, US	28
Cleveland Museum of Natural History, OH (CLEV)location not on record	27
Washington, US	24
Montréal, CA	24
East Lansing, US	23
Philadelphia, US	9
OSUClocation not on record	6
New Haven, US	5
Champaign, US	4
Ressources naturelles Canadalocation not on record	3
Cornell University Insect Collectionlocation not on record	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
University of Guelphlocation not on record	1
Chicago, US	1
US	1

18 institutions · 377 of 495 vouchered records shown · 114 without an institution code

09Environmental DNA10 detections

Where the DNA of Aeshna verticalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.7 °C 6.30–21.0

Seasonal swing summer↔winter25.9 °C

Max temp (day)24.2 °C 11.2–26.4

Min temp (night)16.2 °C 2.40–16.9

Precipitation100 mm/mo 80.2–107

Air humidity60.5 % 58.1–62.2

Moisture balance-34.8 mm/mo -43.4–2.00

Vapour deficit900 Pa 468–1,041

Wind speed2.90 m/s 2.30–3.40

Cloud cover41.2 % 35.5–50.5

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aeshna verticalis

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 760 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 760 records