Aeshna palmata

Hagen, 1856 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Odonata/Aeshnidae/Aeshna

At a glance

Occurrence records5 276

Data sources9

Biological traits0

DNA specimens38

eDNA detections39

Sources9 archives

Databases and archives Aeshna palmata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 276 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI39 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 276 records

Environmental DNA2 datasets · 3 countries39 detections

DNA & barcodingBOLD38 specimens

Genome at a glanceGoaT2n = 28

01Narrative

Paddle-tailed darner (Aeshna palmata) is a species of dragonfly in the family Aeshnidae. It is common throughout western Canada and United States.Dunkle, S.W., Dragonflies through Binoculars: A Field Guide to Dragonflies of North America. New York:Oxford University Press, 2000.Mead, Ken (2009). Dragonflies of the North Woods. 2nd edition. Duluth, MN:Kollath+Stensaas. This species is named after its distinctive paddle-shaped appendages. It lives in many habitats, particularly lakes, ponds, and slow streams, usually with dense shore vegetation.Paulson, Dennis (2009). Dragonflies and Damselflies of the West. Princeton University Press. . p. 221 Aeshna palmata was scientifically described for the first time in 1856 by Hermann Hagen.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aeshna palmata has left across the world's sequence archives.

At a glance

DNA specimens38

BINs4

Marker genes1

eDNA detections39

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus37 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

19Cmostly conserved

100Gmostly conserved

136Cmostly conserved

139Cmostly conserved

304Amostly conserved

562Cmostly conserved

577Gmostly conserved

586Tmostly conserved

595Cmostly conserved

634Cmostly conserved

AACACTTTACTTTTTATTCGGAGCATGATCAGGAATAGTAGGAACTGCTCTAAGAGTTTTAATTCGTATTGAATTAGGACAACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.54%

Haplotypes6

BINs4

Most divergent pair3.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aeshna constrictasame genus2.1%Aeshna umbrosasame genus2.7%Aeshna cyaneasame genus5.0%Aeshna junceasame genus5.2%Aeshna caeruleasame genus5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Aeshna palmata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 271×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

2n 281×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type5 276 records

Wild obs. + sensor3 836

Museum / vouchered1 440

Range

Area of Occupancy AOO10 552 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 1 493≤1 km 665≤10 km 114>10 km 79

2 351 georeferenced · 1 485 without coordinates

Open the mapobservation + sensor3 836

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 67≤1 km 166≤10 km 151>10 km 30

414 georeferenced · 1 026 without coordinates

Open the institutions mapphysical evidence1 440

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Odonata Centrallocation not on record	428
Vancouver, CA	342
Washington, US	84
Toronto, CA	82
Provo, US	36
Cornell University Insect Collectionlocation not on record	35
Sam Noble Oklahoma Museum of Natural Historylocation not on record	21
Chicago, US	20
Edmonton, CA	20
University of Guelph, Centre for Biodiversity Genomicslocation not on record	20
Champaign, US	17
CASlocation not on record	16
San Francisco, US	14
University Park, US	11
Essig Museum of Entomologylocation not on record	10
Philadelphia, US	10
Natural History Museum of Utahlocation not on record	9
UCBMElocation not on record	7
East Lansing, US	4
Albuquerque, US	4
New Haven, US	3
DOI/FWS, Kenai National Wildlife Refugelocation not on record	3
Royal Saskatchewan Museumlocation not on record	3
Blacksburg, US	2
Wuzhou, CN	2
University of Alaska Museumlocation not on record	1
Santa Cruz, US	1
Montréal, CA	1
Colorado State Universitylocation not on record	1
Denver, US	1

30 institutions · 1 208 of 1 440 vouchered records shown · 232 without an institution code

09Environmental DNA39 detections

Where the DNA of Aeshna palmata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found39

Studies independent surveys2

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 39 detections have coordinates

Open the map3 countries0

5. Wetlands | 5.7 Wetlands (inland) - Perman…5. Wetlands | 5.4 Wetlands (inland) - Bogs, …ForestPondbogMixed Habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.4 °C 8.60–16.2

Seasonal swing summer↔winter25.4 °C

Max temp (day)19.9 °C 13.9–22.8

Min temp (night)7.60 °C 3.00–10.6

Precipitation65.5 mm/mo 47.3–118

Air humidity55.8 % 53.1–61.7

Moisture balance-42.5 mm/mo -82.0–11.8

Vapour deficit684 Pa 396–875

Wind speed1.90 m/s 1.80–3.80

Cloud cover36.8 % 33.1–41.5

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aeshna palmata

At a glance

Sources9 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type5 276 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions18 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 276 records