Aeoloplides turnbulli

(Thomas, 1872) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Orthoptera/Acrididae/Aeoloplides

At a glance

Occurrence records564

Data sources8

Biological traits0

DNA specimens5

eDNA detections4

Sources8 archives

Databases and archives Aeoloplides turnbulli's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility564 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF564 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD5 specimens

01Narrative

Aeoloplides turnbulli, known generally as thistle grasshopper, is a species of spur-throated grasshopper in the family Acrididae. Other common names include the Russian thistle grasshopper and saltbush grasshopper. It is found in North America. Thistle grasshopper, Aeoloplides turnbulli

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aeoloplides turnbulli has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.82%

Haplotypes2

BINs2

Most divergent pair0.15%

Where individuals differ — all 13 variable positions, in barcode order

214Tmostly conserved

217Gmostly conserved

262Gmostly conserved

265Amostly conserved

266Tmostly conserved

343Tmostly conserved

346Amostly conserved

355Gmostly conserved

520Cmostly conserved

586Cmostly conserved

592Gmostly conserved

657Tmostly conserved

658Cmostly conserved

TACTTTATACTTTATATTTGGAGCATGAGCTGGAATAGTAGGAACTTCAATAAGAATGATTATTCGAGCAGAACTAGGTCAACCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aeoloplides tenuipennissame genus4.0%Oedaleonotus enigmasame family8.1%Oedaleonotus tenuipennissame family8.2%Indopodisma kingdonisame family9.0%Tonkinacris meridionalissame family9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type564 records

Wild obs. + sensor144

Museum / vouchered420

Range

Area of Occupancy AOO980 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 59≤1 km 37≤10 km 12>10 km 9

117 georeferenced · 27 without coordinates

Open the mapobservation + sensor144

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 8≤1 km 112≤10 km 112>10 km 94

326 georeferenced · 94 without coordinates

Open the institutions mapphysical evidence420

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	209
Universidad Católica de Manizaleslocation not on record	142
US	47
CUlocation not on record	4
Awka, NG	4
	4
Mississippi State, US	3
University of Alabamalocation not on record	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1

9 institutions · 417 of 420 vouchered records shown · 3 without an institution code

09Environmental DNA4 detections

Where the DNA of Aeoloplides turnbulli was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.9 °C 20.7–24.9

Seasonal swing summer↔winter26.3 °C

Max temp (day)31.9 °C 27.9–31.9

Min temp (night)19.7 °C 15.1–19.7

Precipitation64.7 mm/mo 52.6–64.7

Air humidity53.0 % 52.0–53.0

Moisture balance-115 mm/mo -122–-115

Vapour deficit1,488 Pa 1,187–1,488

Wind speed3.90 m/s 3.90–4.00

Cloud cover20.6 % 20.6–31.7

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)