Aeoloplides tenuipennis

(Scudder, 1897) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Orthoptera/Acrididae/Aeoloplides

At a glance

Occurrence records986

Data sources8

Biological traits0

DNA specimens9

eDNA detections17

Sources8 archives

Databases and archives Aeoloplides tenuipennis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility986 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF986 records

Environmental DNA1 datasets · 1 countries17 detections

DNA & barcodingBOLD9 specimens

01Narrative

Aeoloplides tenuipennis, known generally as the narrow-winged saltbush grasshopper or narrow-winged bush grasshopper, is a species of spur-throated grasshopper in the family Acrididae. It is commonly found in eastern California, Arizona and southwestern New Mexico north through Utah and southern Nevada to southern Idaho.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aeoloplides tenuipennis has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections17

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

13Tmostly conserved

22Tvariable

79Tmostly conserved

148Gmostly conserved

206Cvariable

331Gmostly conserved

343Tvariable

353Gmostly conserved

355Avariable

367Tmostly conserved

400Avariable

403Tmostly conserved

421Amostly conserved

430Gmostly conserved

478Amostly conserved

490Tmostly conserved

493Gmostly conserved

542Tmostly conserved

556Tmostly conserved

595Cvariable

631Tmostly conserved

634Cvariable

641Tmostly conserved

TACTTTATACTTTATATTTGGTGCTTGAGCTGGAATAGTAGGAACTTCAATAAGAATAATTATTCGAGCAGAATTAGGTCAACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes4

BIN1

Most divergent pair2.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aeoloplides turnbullisame genus4.0%Indopodisma kingdonisame family8.1%Hesperotettix nevadensissame family8.1%Bradynotes obesasame family8.4%Oedaleonotus enigmasame family8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type986 records

Wild obs. + sensor74

Museum / vouchered912

Range

Area of Occupancy AOO872 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 29≤1 km 10>10 km 10

49 georeferenced · 25 without coordinates

Open the mapobservation + sensor74

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤100 m 9≤1 km 114≤10 km 498>10 km 264

885 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence912

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	533
Provo, US	194
University of Alabamalocation not on record	76
Colorado State Universitylocation not on record	42
OSU-OSAClocation not on record	2
Mississippi State, US	2
US	2
Awka, NG	1

8 institutions · 852 of 912 vouchered records shown · 60 without an institution code

09Environmental DNA17 detections

Where the DNA of Aeoloplides tenuipennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.5 °C 20.2–27.6

Seasonal swing summer↔winter21.6 °C

Max temp (day)30.8 °C 27.4–34.5

Min temp (night)16.1 °C 12.6–20.9

Precipitation12.3 mm/mo 4.20–46.6

Air humidity39.2 % 37.6–42.5

Moisture balance-163 mm/mo -195–-116

Vapour deficit1,672 Pa 1,470–2,294

Wind speed3.30 m/s 1.90–4.00

Cloud cover15.8 % 12.7–38.9

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)