Aeolochroma quadrilinea

(Lucas, 1892) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Aeolochroma

At a glance

Occurrence records123

Data sources8

Biological traits0

DNA specimens73

eDNA detections67

Sources8 archives

Databases and archives Aeolochroma quadrilinea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility123 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI67 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics73 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF123 records

Environmental DNA1 datasets · 1 countries67 detections

DNA & barcodingBOLD73 specimens

01Narrative

Aeolochroma quadrilinea is a moth of the family Geometridae first described by Thomas Pennington Lucas in 1892. It is found in Queensland, Australia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding73 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aeolochroma quadrilinea has left across the world's sequence archives.

At a glance

DNA specimens73

BINs1

Marker genes2

eDNA detections67

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus65 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

AACTCTATATTTTATTTTTGGAATTTGAGCAGGAATAATCGGAACTTCTTTAAGTTTATTAATTCGAGCAGAATTAGGTAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.11%

Haplotypes9

BIN1

Most divergent pair0.30%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aeolochroma unitariasame genus4.6%Aeolochroma melaleucaesame genus5.0%Herochroma orientalissame family5.5%Aeolochroma metarhodatasame genus5.6%Aeolochroma hypochromariasame genus5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type123 records

Wild obs. + sensor117

Museum / vouchered6

Range

Area of Occupancy AOO256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 48≤1 km 33≤10 km 1>10 km 9

91 georeferenced · 26 without coordinates

Open the mapobservation + sensor117

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	1

1 institutions · 1 of 6 vouchered records shown · 5 without an institution code

09Environmental DNA67 detections

Where the DNA of Aeolochroma quadrilinea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found67

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 67 detections have coordinates

Open the map1 country0

Dry Sclerophyll Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.4 °C 21.8–23.5

Seasonal swing summer↔winter8.60 °C

Max temp (day)23.8 °C 23.6–26.6

Min temp (night)20.9 °C 19.0–22.1

Precipitation110 mm/mo 65.4–148

Air humidity61.6 % 60.9–62.0

Vapour deficit1,033 Pa 1,003–1,110

Cloud cover27.4 % 26.0–31.7

CHELSA 1981–2010, ~9 km grid, at location & month of 67 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)