Aeolochroma metarhodata

(Walker, 1863) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Aeolochroma

At a glance

Occurrence records936

Data sources8

Biological traits0

DNA specimens35

eDNA detections32

Sources8 archives

Databases and archives Aeolochroma metarhodata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility936 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF936 records

Environmental DNA1 datasets · 1 countries32 detections

DNA & barcodingBOLD35 specimens

01Narrative

Aeolochroma metarhodata, the tea-tree emerald, is a moth of the family Geometridae first described by Francis Walker in 1863. It is found in the Australian states of Queensland, New South Wales, and Victoria. The larvae feed on Leptospermum polygalifolium.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aeolochroma metarhodata has left across the world's sequence archives.

At a glance

DNA specimens35

BINs2

Marker genes2

eDNA detections32

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

40Tmostly conserved

59Cmostly conserved

106Cmostly conserved

340Tmostly conserved

466Amostly conserved

487Cmostly conserved

499Amostly conserved

517Gmostly conserved

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAATTGGAACTTCATTAAGTTTACTAATTCGAGCAGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.38%

Haplotypes7

BINs2

Most divergent pair1.1%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aeolochroma quadrilineasame genus5.6%Aeolochroma mniariasame genus5.8%Aeolochroma unitariasame genus6.5%Aeolochroma hypochromariasame genus6.8%Ornithospila aviculariasame family7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type936 records

Wild obs. + sensor826

Museum / vouchered110

Range

Area of Occupancy AOO1 036 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 372≤1 km 216≤10 km 29>10 km 23

640 georeferenced · 186 without coordinates

Open the mapobservation + sensor826

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 6≤10 km 2

8 georeferenced · 102 without coordinates

Open the institutions mapphysical evidence110

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Museums Victorialocation not on record	105
DPIlocation not on record	2
Australian National Insect Collectionlocation not on record	1

3 institutions · 108 of 110 vouchered records shown · 2 without an institution code

09Environmental DNA32 detections

Where the DNA of Aeolochroma metarhodata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found32

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 32 detections have coordinates

Open the map1 country0

Dry Sclerophyll Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.4 °C 17.3–23.5

Seasonal swing summer↔winter8.60 °C

Max temp (day)23.8 °C 20.9–25.3

Min temp (night)20.9 °C 12.4–22.1

Precipitation110 mm/mo 62.8–147

Air humidity61.4 % 57.2–61.9

Vapour deficit1,033 Pa 849–1,109

Cloud cover27.4 % 19.5–31.0

CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)