Aeolidiella glauca

(Alder & Hancock, 1845) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Aeolidiidae/Aeolidiella

At a glance

Occurrence records1 307

Data sources8

Biological traits2

DNA specimens26

eDNA detections26

Sources8 archives

Databases and archives Aeolidiella glauca's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 171 records↗

OBISOcean Biodiversity Information System136 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS1 307 records

Environmental DNA2 datasets · 3 countries26 detections

DNA & barcodingBOLD26 specimens

01Narrative

Aeolidiella glauca is a species of sea slug, an aeolid nudibranch in the family Aeolidiidae.Gofas, S. (2015). Aeolidiella glauca (Alder & Hancock, 1845). In: MolluscaBase (2015). Accessed through: World Register of Marine Species on 2015-11-14

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aeolidiella glauca has left across the world's sequence archives.

At a glance

DNA specimens26

BINs2

Marker genes1

eDNA detections26

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 35 variable positions, in barcode order

56Tmostly conserved

76Avariable

88Gvariable

127Cmostly conserved

169Tvariable

193Cmostly conserved

209Tvariable

220Cvariable

238Cmostly conserved

271Tvariable

274Cvariable

292Gmostly conserved

295Tvariable

298Tvariable

313Tvariable

364Tvariable

379Avariable

391Gvariable

406Cvariable

412Cmostly conserved

421Tvariable

425Tmostly conserved

428Tmostly conserved

445Tmostly conserved

475Cvariable

499Cvariable

508Cvariable

532Cvariable

553Gvariable

562Gmostly conserved

571Cvariable

574Cvariable

604Cvariable

616Tmostly conserved

628Cvariable

TACCTTATATGTTCTTTTAGGTATATGATGTGGGTTGGCTGGAACTGGTTTAAGTTTATTAATTCGTTTTGAACTAGGAACAGCCGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.2%

Haplotypes6

BINs2

Most divergent pair4.7%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aeolidiella sanguineasame genus7.8%Aeolidiella alderisame genus15.7%Berghia norvegicasame family16.4%Babakina indopacificasame order16.9%Doto pinnatifidasame order17.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 307 records

Wild obs. + sensor1 102

Museum / vouchered191

Other14

Range

Area of Occupancy AOO1 160 km²

Depth

0–200 m sunlit74

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 13.8 m · max 28.5 m · 74 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 468≤1 km 82≤10 km 28>10 km 2

580 georeferenced · 522 without coordinates

Open the mapobservation + sensor1 102

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 24≤1 km 17≤10 km 15>10 km 4

60 georeferenced · 131 without coordinates

Open the institutions mapphysical evidence191

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Gothenburg, SE	21
DASSHlocation not on record	16
Bergen, NO	14
NTNU-VMlocation not on record	10
SLU Artdatabankenlocation not on record	4
PNHSlocation not on record	3
CASlocation not on record	1
Goteborg Natural History Museumlocation not on record	1

8 institutions · 70 of 191 vouchered records shown · 1 without an institution code

09Environmental DNA26 detections

Where the DNA of Aeolidiella glauca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found26

Studies independent surveys2

Countries3

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 26 detections have coordinates

Open the map3 countries0

RockMixed bottomPipeHard substrate

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.1 °C 2.30–15.4

Seasonal swing summer↔winter16.6 °C

Max temp (day)15.1 °C 4.90–18.2

Min temp (night)5.70 °C -1.20–12.1

Precipitation61.7 mm/mo 52.2–74.8

Air humidity61.7 % 57.4–65.6

Moisture balance-22.2 mm/mo

Vapour deficit550 Pa 289–668

Wind speed3.70 m/s

Cloud cover47.8 % 38.5–51.6

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aeolidiella glauca

At a glance

Sources8 archives

Habitat & environment2

At a glance

Record type1 307 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 307 records