Aeolidiella alderi

(Cocks, 1852) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Aeolidiidae/Aeolidiella

At a glance

Occurrence records766

Data sources8

Biological traits2

DNA specimens10

eDNA detections7

Sources8 archives

Databases and archives Aeolidiella alderi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility736 records↗

OBISOcean Biodiversity Information System30 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS766 records

Environmental DNA1 datasets · 4 countries7 detections

DNA & barcodingBOLD10 specimens

01Narrative

Aeolidiella alderi is a species of sea slug, an aeolid nudibranch in the family Aeolidiidae.Gofas, S. (2015). Aeolidiella alderi (Cocks, 1852). In: MolluscaBase (2015). Accessed through: World Register of Marine Species on 2015-11-12 It is native to northwestern Europe where it occurs in the intertidal zone. It is a predator and feeds on sea anemones.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aeolidiella alderi has left across the world's sequence archives.

At a glance

DNA specimens10

BINs3

Marker genes1

eDNA detections7

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 70 variable positions, in barcode order

13Tmostly conserved

31Cvariable

34Gmostly conserved

35Cmostly conserved

43Avariable

50Tmostly conserved

59Cmostly conserved

79Gmostly conserved

85Amostly conserved

88Avariable

100Tmostly conserved

109Tmostly conserved

163Amostly conserved

166Amostly conserved

193Tmostly conserved

196Gmostly conserved

205Tmostly conserved

223Gmostly conserved

229Amostly conserved

235Tmostly conserved

268Amostly conserved

271Amostly conserved

274Cmostly conserved

304Amostly conserved

310Gmostly conserved

331Gmostly conserved

334Amostly conserved

343Avariable

346Gmostly conserved

347Cmostly conserved

349Gmostly conserved

352Tvariable

355Gmostly conserved

361Avariable

364Tmostly conserved

370Amostly conserved

373Cvariable

382Amostly conserved

385Cvariable

391Cvariable

407Tmostly conserved

412Gmostly conserved

433Gmostly conserved

442Cmostly conserved

460Cmostly conserved

466Avariable

472Cvariable

478Gvariable

487Amostly conserved

493Amostly conserved

494Cmostly conserved

496Amostly conserved

499Amostly conserved

511Avariable

542Cvariable

556Avariable

574Tmostly conserved

578Tmostly conserved

580Amostly conserved

583Amostly conserved

589Tmostly conserved

604Tvariable

607Tmostly conserved

616Tmostly conserved

619Tmostly conserved

631Gvariable

637Tmostly conserved

643Amostly conserved

646Tmostly conserved

649Amostly conserved

TACTTTATATGTTCTTTTAGGTATGTGATGCGGGCTGGCTGGAACTGGTTTAAGTTTACTAATTCGATTTGAATTAGGGACTGCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.6%

Haplotypes4

BINs3

Most divergent pair4.7%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Babakina indopacificasame order13.4%Aeolidiella sanguineasame genus14.5%Coryphella trophinasame order15.5%Berghia norvegicasame family16.1%Aeolidia filomenaesame family16.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type766 records

Wild obs. + sensor716

Museum / vouchered42

Other8

Range

Area of Occupancy AOO844 km²

Depth

0–200 m sunlit3

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 29 m · max 35.4 m · 3 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 434≤1 km 75≤10 km 33>10 km 5

547 georeferenced · 169 without coordinates

Open the mapobservation + sensor716

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 1≤1 km 6≤10 km 2

9 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence42

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	5
CASlocation not on record	4
Museo Nacional de Ciencias Naturales (CSIC)location not on record	2
Natural History Museum, Londonlocation not on record	2
South Kensington, GB	2
Museo Nacional de Ciencias Naturaleslocation not on record	1
AUTHlocation not on record	1
DASSHlocation not on record	1
PNHSlocation not on record	1

9 institutions · 19 of 42 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Aeolidiella alderi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 12.6–20.3

Seasonal swing summer↔winter14.3 °C

Max temp (day)18.4 °C 16.0–22.8

Min temp (night)12.2 °C 8.10–18.3

Precipitation72.2 mm/mo 33.5–78.2

Air humidity60.6 % 59.0–62.5

Moisture balance-8.00 mm/mo

Vapour deficit734 Pa 590–999

Wind speed4.60 m/s

Cloud cover41.8 % 36.5–43.1

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)