Aeolidia papillosa

(Linnaeus, 1761) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Aeolidiidae/Aeolidia

At a glance

Occurrence records4 000

Data sources10

Biological traits6

DNA specimens167

eDNA detections301

Sources10 archives

Databases and archives Aeolidia papillosa's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 180 records↗

OBISOcean Biodiversity Information System820 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI301 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics167 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS4 000 records

Environmental DNA4 datasets · 12 countries301 detections

DNA & barcodingBOLD167 specimens

Genome at a glanceNCBI≈167 Mbp

01Narrative

Aeolidia papillosa, known as the common grey sea slug, is a species of nudibranch in the family Aeolidiidae.Gofas, S. Aeolidia papillosa. In: MolluscaBase (2017). Accessed through: World Register of Marine Species (WoRMS), 26 July 2017.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length10 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits3

Depth max380 m

Depth min0 m

Vulnerability10

05DNA & barcoding167 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aeolidia papillosa has left across the world's sequence archives.

At a glance

DNA specimens167

BINs4

Marker genes6

eDNA detections301

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus147 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 50 variable positions, in barcode order

25Gmostly conserved

28Gmostly conserved

34Amostly conserved

56Cmostly conserved

59Tvariable

88Cmostly conserved

95Cmostly conserved

106Cvariable

109Tmostly conserved

118Tmostly conserved

133Amostly conserved

170Tmostly conserved

184Gmostly conserved

190Cmostly conserved

193Tmostly conserved

202Tmostly conserved

208Tmostly conserved

211Amostly conserved

298Amostly conserved

304Gmostly conserved

310Gvariable

313Gmostly conserved

319Avariable

322Gmostly conserved

328Cvariable

340Tmostly conserved

349Gvariable

358Gmostly conserved

364Tmostly conserved

370Cmostly conserved

400Tmostly conserved

403Gmostly conserved

418Gmostly conserved

424Cmostly conserved

436Tmostly conserved

442Tmostly conserved

460Cmostly conserved

499Tmostly conserved

508Amostly conserved

542Tmostly conserved

553Gmostly conserved

565Avariable

568Tmostly conserved

578Tmostly conserved

581Tmostly conserved

586Amostly conserved

589Cmostly conserved

595Tmostly conserved

625Tvariable

628Cvariable

TACTCTCTATGTTCTTTTAGGGATGTGGTGTGGATTAGCAGGAACAGGTTTAAGACTGTTAATTCGATTTGAATTAGGAACTGCTGGCGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes33

BINs4

Most divergent pair13.7%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aeolidia filomenaesame genus11.6%Coryphella trophinasame order16.0%Aeolidiella alderisame family16.6%Coryphella lineatasame order16.6%Doto pinnatifidasame order16.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S18S-3P18S-5P18S-V4CYTB

animal barcoderibosomalmitochondrial

06Genome at a glanceNCBI

The complete instruction manual Aeolidia papillosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈166 752 208 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Aeolidia papillosa0.17 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type4 000 records

Wild obs. + sensor2 780

Museum / vouchered1 132

Other88

Range

Area of Occupancy AOO5 392 km²

Depth

0–200 m sunlit313

200–1000 m twilight2

1–4 km midnight0

>4 km abyssal0

median 10.7 m · max 380 m · 315 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 994≤1 km 313≤10 km 174>10 km 158

1 639 georeferenced · 1 141 without coordinates

Open the mapobservation + sensor2 780

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 120≤1 km 112≤10 km 105>10 km 35

372 georeferenced · 760 without coordinates

Open the institutions mapphysical evidence1 132

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NTNU-VMlocation not on record	88
CASlocation not on record	80
DASSHlocation not on record	32
Gothenburg, SE	25
Victoria, CA	25
Bergen, NO	24
Santa Barbara Museum of Natural Historylocation not on record	21
New Haven, US	21
Cambridge, US	19
Washington, US	16
Philadelphia, US	14
PNHSlocation not on record	12
Maurice Lamontagne Institutelocation not on record	10
Natural History Museum Rotterdamlocation not on record	9
Zoological Museum, Moscow Lomonosov State Universitylocation not on record	7
Research Institute for Agriculture, Fisheries and Food (ILVO)location not on record	6
Tromsø, NO	4
Helsinki, FI	4
630location not on record	4
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	3
Edmonton, CA	3
Saint John, CA	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
University Museum of Bergen, Natural History Collectionslocation not on record	3
MZLUlocation not on record	3
Buenos Aires, AR	2
The Atlantic reference Centrelocation not on record	2
Smithsonian Institution National Museum of Natural History, Department of Invertebrate Zoologylocation not on record	2
Stanford Universitylocation not on record	2
Florida Museum of Natural Historylocation not on record	2
North Carolina Museum of Natural Scienceslocation not on record	1
fcnym.unlp.edu.arlocation not on record	1
CEFASlocation not on record	1
Natural History Museum, Londonlocation not on record	1
Citadel Hill, GB	1
South Kensington, GB	1
Universidad Católica del Nortelocation not on record	1
A.V. Zhirmunsky National Scientific Center of Marine Biology Far Eastern Branch, Russian Academy of Sciences (NSCMB FEB RAS)location not on record	1

39 institutions · 460 of 1 132 vouchered records shown · 14 without an institution code

09Environmental DNA301 detections

Where the DNA of Aeolidia papillosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found301

Studies independent surveys4

Countries12

Verifiable raw sequence linked145

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 301 detections have coordinates

Open the map12 countries0

marineHard substrateOn rockMixed bottomrocky reefRock

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature14.4 °C 11.6–18.6

pH8.02 7.83–8.05

Conductivity45,000 µS/cm 37,000–53,000

Salinity29.3 PSU 23.6–34.8

Dissolved oxygen7.90 mg/L 4.24–8.15

Turbidity0.95 NTU 0.48–1.58

Depth15.0 m 0.5–23.0

Coastal water

5 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.90 °C -1.30–17.2

Seasonal swing summer↔winter23.4 °C

Max temp (day)13.5 °C 1.70–21.1

Min temp (night)6.50 °C -4.20–14.6

Precipitation115 mm/mo 61.7–130

Air humidity63.2 % 60.3–65.0

Moisture balance38.8 mm/mo -11.5–92.4

Vapour deficit468 Pa 225–689

Wind speed2.40 m/s 1.80–6.00

Cloud cover54.7 % 44.3–65.9

CHELSA 1981–2010, ~9 km grid, at location & month of 210 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aeolidia papillosa

At a glance

Sources10 archives

Size & morphology1

Habitat & environment2

Other traits3

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type4 000 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 39 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type4 000 records