Aenetus lewinii

(Walker, 1856) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hepialidae/Aenetus

At a glance

Occurrence records51

Data sources6

Biological traits0

DNA specimens8

eDNA detections7

Sources6 archives

Databases and archives Aenetus lewinii's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility51 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF51 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD8 specimens

01Narrative

Aenetus lewinii is a moth of the family Hepialidae. It is known from New South Wales and Queensland.Australian Faunal Directory The larvae feed on various trees, including Casuarina and Leptospermum species. They bore in the stems of saplings.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aenetus lewinii has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

16Tmostly conserved

25Tmostly conserved

103Tmostly conserved

115Cmostly conserved

200Gmostly conserved

202Cmostly conserved

235Cmostly conserved

271Tvariable

343Cmostly conserved

433Gmostly conserved

496Gmostly conserved

625Avariable

631Amostly conserved

AACTTTATATTTTATTTTTGGAATTTGATCAGGTATAGTTGGAACATCGTTAAGATTATTAATTCGAACAGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.79%

Haplotypes5

BIN1

Most divergent pair1.5%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aenetus scottisame genus5.9%Aenetus ligniverensame genus6.1%Aenetus dulcissame genus6.2%Aenetus scriptasame genus6.5%Aenetus astathessame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type51 records

Wild obs. + sensor40

Museum / vouchered11

Range

Area of Occupancy AOO168 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 19≤1 km 6≤10 km 3>10 km 6

34 georeferenced · 6 without coordinates

Open the mapobservation + sensor40

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤1 km 2≤10 km 1

3 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tasmanian Museum & Art Gallerylocation not on record	2
Sydney, AU	2
Museums Victorialocation not on record	1
Natick, US	1
DPIlocation not on record	1

5 institutions · 7 of 11 vouchered records shown · 4 without an institution code

09Environmental DNA7 detections

Where the DNA of Aenetus lewinii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 18.5–23.8

Seasonal swing summer↔winter8.80 °C

Max temp (day)24.1 °C 22.8–26.3

Min temp (night)19.6 °C 14.5–22.1

Precipitation138 mm/mo 97.6–179

Air humidity61.7 % 59.8–62.4

Vapour deficit1,021 Pa 836–1,131

Cloud cover28.3 % 24.3–31.8

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)