Aenetus eximia

(Scott, 1869) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hepialidae/Aenetus

At a glance

Occurrence records288

Data sources6

Biological traits0

DNA specimens6

eDNA detections6

Sources6 archives

Databases and archives Aenetus eximia's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility288 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF288 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD6 specimens

01Narrative

Aenetus eximia is a moth of the family Hepialidae. It is known from southern Queensland, Australia, to Tasmania. The wingspan is about 70 mm. Adult males are blue-green. Females are green with two spots on each forewing. The hindwings are orange with green borders.Australian Insects The larvae feed on a wide range of plants, including Syzygium smithii, Eucalyptus grandis, Waterhousea floribunda, Tristaniopsis, Doryphora sassafrass, Daphnandra micrantha, Glochidion ferdinandi, Nothofagus moorei, Prostanthera lasianthos, Dodonaea viscosa, Diploglottis australis, Pomaderris aspera, Dendrocnide excelsa, Lantana camara and Olearia argophylla.Australian Faunal Directory They live in tunnels and dig down into the trunk and root of their host plant. Pupation takes place inside the tunnel.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aenetus eximia has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections6

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)1.4%

Haplotypes1

BIN1

Where individuals differ — all 15 variable positions, in barcode order

50Cmostly conserved

85Tmostly conserved

92Cmostly conserved

157Cmostly conserved

190Gmostly conserved

217Gmostly conserved

343Cvariable

370Avariable

481Gvariable

484Gvariable

496Avariable

500Cvariable

553Cvariable

571Cvariable

581Cvariable

AACTTTATACTTTATTTTTGGAATTTGATCAGGTATAGTTGGAACATCCCTAAGATTATTGATTCGAACAGAATTAGGAAACCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aenetus scottisame genus6.7%Aenetus scriptasame genus7.3%Aenetus tegulatussame genus7.3%Aenetus astathessame genus7.6%Aenetus dulcissame genus7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type288 records

Wild obs. + sensor237

Museum / vouchered51

Range

Area of Occupancy AOO748 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 72≤1 km 61≤10 km 39>10 km 12

184 georeferenced · 53 without coordinates

Open the mapobservation + sensor237

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 1≤1 km 10≤10 km 6>10 km 3

20 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence51

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	25
Tasmanian Museum & Art Gallerylocation not on record	10
Australian National Insect Collectionlocation not on record	3
Sydney, AU	3
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	2
New Haven, US	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Australian National Fish Collectionlocation not on record	1

8 institutions · 46 of 51 vouchered records shown · 5 without an institution code

09Environmental DNA6 detections

Where the DNA of Aenetus eximia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 12.6–19.5

Seasonal swing summer↔winter10.6 °C

Max temp (day)22.8 °C 17.0–25.2

Min temp (night)12.9 °C 8.60–15.1

Precipitation85.0 mm/mo 65.6–108

Air humidity58.8 % 56.5–60.3

Moisture balance-32.7 mm/mo -50.8–-18.9

Vapour deficit834 Pa 625–932

Wind speed2.80 m/s 1.70–3.90

Cloud cover23.1 % 17.6–26.6

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)