Aellopos fadus

Cramer, 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Sphingidae/Aellopos

At a glance

Occurrence records352

Data sources6

Biological traits0

DNA specimens70

eDNA detections46

Sources6 archives

Databases and archives Aellopos fadus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility352 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI46 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics70 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF352 records

Environmental DNA1 datasets · 5 countries46 detections

DNA & barcodingBOLD70 specimens

01Narrative

Aellopos fadus est une espèce de papillons, de la famille des Sphingidés.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding70 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aellopos fadus has left across the world's sequence archives.

At a glance

DNA specimens70

BINs2

Marker genes1

eDNA detections46

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus42 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCAGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.32%

Haplotypes9

BINs2

Most divergent pair5.5%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aellopos titansame genus5.2%Aellopos clavipessame genus6.1%Nyceryx maxwellisame family6.4%Eupyrrhoglossum sagrasame family6.4%Perigonia luscasame family7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type352 records

Wild obs. + sensor212

Museum / vouchered139

Other1

Range

Area of Occupancy AOO916 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 98≤1 km 39≤10 km 12>10 km 22

171 georeferenced · 41 without coordinates

Open the mapobservation + sensor212

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 17≤10 km 4

21 georeferenced · 118 without coordinates

Open the institutions mapphysical evidence139

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	49
University of Pennsylvanialocation not on record	26
FLMNH-UFlocation not on record	15
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	7
New Haven, US	4
Cleveland Museum of Natural History, OH (CLEV)location not on record	4
The University of the West Indies, Trinidad and Tobagolocation not on record	3
Uniwersytet Jagiellońskilocation not on record	2
South Kensington, GB	2
Chicago, US	1
Mexico City, MX	1
Mayagüez, PR	1

12 institutions · 115 of 139 vouchered records shown · 24 without an institution code

09Environmental DNA46 detections

Where the DNA of Aellopos fadus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found46

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 46 detections have coordinates

Open the map5 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 23.2–25.7

Seasonal swing summer↔winter2.00 °C

Max temp (day)27.6 °C 26.5–27.9

Min temp (night)23.1 °C 19.7–24.1

Precipitation242 mm/mo 104–349

Air humidity69.0 % 61.8–72.5

Moisture balance92.6 mm/mo -46.7–196

Vapour deficit989 Pa 822–1,053

Wind speed3.60 m/s 2.00–4.20

Cloud cover38.6 % 22.0–46.2

CHELSA 1981–2010, ~9 km grid, at location & month of 45 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)