Aellopos clavipes

Rothschild & Jordan, 1903 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Sphingidae/Aellopos

At a glance

Occurrence records664

Data sources7

Biological traits0

DNA specimens32

eDNA detections19

Sources7 archives

Databases and archives Aellopos clavipes's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility664 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF664 records

Environmental DNA1 datasets · 4 countries19 detections

DNA & barcodingBOLD32 specimens

01Narrative

Aellopos clavipes, also known as the clavipes sphinx, is a moth of the family Sphingidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aellopos clavipes has left across the world's sequence archives.

At a glance

DNA specimens32

BINs2

Marker genes1

eDNA detections19

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

46Cmostly conserved

50Tmostly conserved

133Cmostly conserved

217Amostly conserved

232Amostly conserved

238Tmostly conserved

340Cmostly conserved

364Tmostly conserved

370Cmostly conserved

388Amostly conserved

397Tmostly conserved

433Amostly conserved

448Tmostly conserved

457Cmostly conserved

463Tmostly conserved

469Tmostly conserved

517Gmostly conserved

604Gmostly conserved

616Cmostly conserved

625Amostly conserved

641Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCATTAAGATTATTAATTCGAGCAGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.74%

Haplotypes4

BINs2

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aellopos titansame genus4.4%Aellopos tantalussame genus5.3%Nyceryx maxwellisame family5.6%Perigonia luscasame family5.9%Nyceryx continuasame family6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type664 records

Wild obs. + sensor452

Museum / vouchered212

Range

Area of Occupancy AOO1 476 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 211≤1 km 75≤10 km 49>10 km 21

356 georeferenced · 96 without coordinates

Open the mapobservation + sensor452

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 98≤1 km 3≤10 km 16>10 km 5

122 georeferenced · 90 without coordinates

Open the institutions mapphysical evidence212

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
FLMNH-UFlocation not on record	71
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	45
Mexico City, MX	36
National Biodiversity Institute, Costa Ricalocation not on record	20
University of Pennsylvanialocation not on record	11
New Haven, US	8
Tapachula, MX	8
San Diego, US	5
East Lansing, US	2
PUC-RSlocation not on record	2
Natural History Museum of Utahlocation not on record	1

11 institutions · 209 of 212 vouchered records shown · 3 without an institution code

09Environmental DNA19 detections

Where the DNA of Aellopos clavipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map4 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…1. Forest & Woodland|1.5. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.9 °C 20.9–25.7

Seasonal swing summer↔winter2.50 °C

Max temp (day)27.4 °C 24.8–29.9

Min temp (night)21.0 °C 16.3–23.3

Precipitation195 mm/mo 41.8–374

Air humidity67.1 % 54.2–72.2

Moisture balance65.8 mm/mo -83.6–228

Vapour deficit1,013 Pa 849–1,347

Wind speed3.20 m/s 1.80–4.10

Cloud cover30.7 % 16.4–46.0

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)