Aegopinella nitidula

(Draparnaud, 1805) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Stylommatophora/Gastrodontidae/Aegopinella

At a glance

Occurrence records19 787

Data sources9

Biological traits2

DNA specimens18

eDNA detections2

Sources9 archives

Databases and archives Aegopinella nitidula's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility19 787 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF19 787 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD18 specimens

01Narrative

Aegopinella nitidula (previously known as Retinella nitidula) is a species of small land snail, a terrestrial pulmonate gastropod mollusk in the family Gastrodontidae, the glass snails. Forsyth et al. (2001) reviews its identification and ecology.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aegopinella nitidula has left across the world's sequence archives.

At a glance

DNA specimens18

BINs2

Marker genes2

eDNA detections2

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P608 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 83% of positions are identical in every specimen.

Where individuals differ — all 106 variable positions, in barcode order

3Gvariable

4Cvariable

12Gvariable

18Cmostly conserved

21Gmostly conserved

33Amostly conserved

36Amostly conserved

39Amostly conserved

42Tmostly conserved

45Amostly conserved

46Tmostly conserved

48Amostly conserved

51Gvariable

72Gmostly conserved

78Cmostly conserved

84Tmostly conserved

90Tmostly conserved

96Amostly conserved

114Avariable

120Tmostly conserved

121Gmostly conserved

132Tvariable

135Amostly conserved

138Cmostly conserved

141Gmostly conserved

144Tmostly conserved

147Amostly conserved

150Gmostly conserved

156Amostly conserved

163Avariable

171Cmostly conserved

174Tmostly conserved

180Amostly conserved

183Amostly conserved

186Cmostly conserved

192Amostly conserved

207Amostly conserved

213Gmostly conserved

214Tmostly conserved

216Amostly conserved

222Tmostly conserved

228Tmostly conserved

232Gmostly conserved

238Cmostly conserved

240Tmostly conserved

244Tmostly conserved

245Gmostly conserved

246Tmostly conserved

249Amostly conserved

252Amostly conserved

255Gmostly conserved

258Tmostly conserved

264Cmostly conserved

270Cvariable

276Amostly conserved

279Amostly conserved

291Cvariable

306Cmostly conserved

309Amostly conserved

312Tmostly conserved

315Gmostly conserved

321Amostly conserved

327Tmostly conserved

330Amostly conserved

337Cmostly conserved

339Tmostly conserved

351Cmostly conserved

352Cmostly conserved

354Tmostly conserved

360Gmostly conserved

363Tvariable

366Gmostly conserved

372Avariable

405Tmostly conserved

417Gmostly conserved

420Amostly conserved

423Tmostly conserved

426Avariable

429Amostly conserved

447Tmostly conserved

459Amostly conserved

462Amostly conserved

465Amostly conserved

468Cmostly conserved

477Amostly conserved

480Gmostly conserved

487Tmostly conserved

490Cmostly conserved

492Tmostly conserved

498Amostly conserved

504Tmostly conserved

507Tmostly conserved

510Gmostly conserved

513Gvariable

516Amostly conserved

519Tmostly conserved

525Tmostly conserved

543Tmostly conserved

558Gmostly conserved

570Tmostly conserved

576Tmostly conserved

579Amostly conserved

582Tmostly conserved

585Tmostly conserved

597Tmostly conserved

606Gmostly conserved

GGGCTATCTTTGTTAATCCGGTTAGAATTAGGAACATCAGGTGTATTAATGGATGATCATTTTTTTAATGTGATTGTCACAGCTCATGCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)6.3%

Haplotypes4

BINs2

Most divergent pair16.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aegopinella epipedostomasame genus8.3%Aegopinella minorsame genus8.9%Aegopinella purasame genus10.9%Aegopinella nitenssame genus11.7%Glyphyalinia indentatasame family12.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS2

animal barcodefungal barcode

08Occurrence & distribution

Record type19 787 records

Wild obs. + sensor17 058

Museum / vouchered2 672

Fossil57

Range

Area of Occupancy AOO42 648 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 6 218≤1 km 3 207≤10 km 6 970>10 km 25

16 420 georeferenced · 638 without coordinates

Open the mapobservation + sensor17 058

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy90% within 1 km

≤100 m 643≤1 km 49≤10 km 74>10 km 1

767 georeferenced · 1 905 without coordinates

Open the institutions mapphysical evidence2 672

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Gothenburg, SE	1 489
SLU Artdatabankenlocation not on record	578
Adam Mickiewicz University in Poznańlocation not on record	107
SNSDlocation not on record	82
Natural History Museum Rotterdamlocation not on record	39
Barcelona, ES	34
Philadelphia, US	30
John May Museum of Natural Historylocation not on record	30
Provincia di Livornolocation not on record	17
Helsinki, FI	15
CBDClocation not on record	15
BioFokuslocation not on record	15
Paris, FR	15
MZLUlocation not on record	13
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	13
Chongqing Museumlocation not on record	9
Victoria, CA	6
Delaware Museum of Nature and Sciencelocation not on record	4
Metsähallituslocation not on record	3
Bourges, FR	2
Stockholm, SE	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	2
Toronto, CA	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Natural History Museum of Utahlocation not on record	1
NTNU-VMlocation not on record	1
Salzburg, AT	1
Cambridge, US	1
Chicago, US	1
South Kensington, GB	1

31 institutions · 2 531 of 2 672 vouchered records shown · 140 without an institution code

09Environmental DNA2 detections

Where the DNA of Aegopinella nitidula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.30 °C 7.30–7.30

Seasonal swing summer↔winter18.1 °C

Max temp (day)10.8 °C

Min temp (night)3.60 °C

Precipitation71.4 mm/mo

Air humidity64.2 %

Moisture balance4.30 mm/mo

Vapour deficit417 Pa

Wind speed4.10 m/s

Cloud cover41.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aegopinella nitidula

At a glance

Sources9 archives

Diet & foraging2

At a glance

Record type19 787 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type19 787 records