Aegopinella nitens

(Michaud, 1831) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Stylommatophora/Gastrodontidae/Aegopinella

At a glance

Occurrence records22 676

Data sources8

Biological traits0

DNA specimens10

eDNA detections1

Sources8 archives

Databases and archives Aegopinella nitens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility22 676 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF22 676 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD10 specimens

01Narrative

Aegopinella nitens is a species of small land snail, a terrestrial pulmonate gastropod mollusk in the family Gastrodontidae, the glass snails.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aegopinella nitens has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P622 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.11%

Haplotypes2

BIN1

Most divergent pair0.16%

Where individuals differ — all 1 variable positions, in barcode order

318Cvariable

GTGGGGACCGGGTTGTCTTTACTAATTCGGTTAGAGTTAGGAACATCGGGGGTATTAATAGATGACCATTTTTTTAATGTGATTGTTACA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aegopinella minorsame genus11.7%Aegopinella nitidulasame genus11.7%Aegopinella epipedostomasame genus12.8%Aegopinella purasame genus13.7%Glyphyalinia indentatasame family15.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type22 676 records

Wild obs. + sensor9 096

Museum / vouchered13 529

Other51

Origin

Native9 658

Range

Area of Occupancy AOO10 788 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy7% within 1 km

≤100 m 468≤1 km 204≤10 km 8 302>10 km 20

8 994 georeferenced · 102 without coordinates

Open the mapobservation + sensor9 096

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤100 m 92≤1 km 511≤10 km 11 548>10 km 54

12 205 georeferenced · 1 324 without coordinates

Open the institutions mapphysical evidence13 529

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paro, BT	5 226
Bern, CH	2 560
Salzburg, AT	966
Provincia di Livornolocation not on record	466
Universität Zürich, Naturhistorisches Museumlocation not on record	460
Musee d'Histoire Naturallelocation not on record	266
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	160
Fribourg, CH	115
Adam Mickiewicz University in Poznańlocation not on record	79
Frauenfeld, CH	73
Dhaka, BD	73
Barcelona, ES	62
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	48
Geneva, CH	22
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	13
EVMGlocation not on record	13
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	10
Sion, CH	10
Winterthur, CH	8
HNClocation not on record	8
Natural History Museum Rotterdamlocation not on record	7
Cambridge, US	6
Naturama Aargaulocation not on record	6
SNSDlocation not on record	4
ZSMlocation not on record	4
Archäologie und Museum Baselland - Museum.BLlocation not on record	4
Helsinki, FI	3
Bavarian State Collection of Zoologylocation not on record	3
ZIBElocation not on record	2
John May Museum of Natural Historylocation not on record	2
Naturmuseum Solothurnlocation not on record	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
MZLUlocation not on record	1

34 institutions · 10 684 of 13 529 vouchered records shown · 2 845 without an institution code

09Environmental DNA1 detections

Where the DNA of Aegopinella nitens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.9 °C 12.9–12.9

Seasonal swing summer↔winter18.1 °C

Max temp (day)17.2 °C

Min temp (night)7.60 °C

Precipitation103 mm/mo

Air humidity59.1 %

Moisture balance-3.30 mm/mo

Vapour deficit609 Pa

Wind speed2.30 m/s

Cloud cover36.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aegopinella nitens

At a glance

Sources8 archives

At a glance

Record type22 676 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type22 676 records