Aedes vittatus

(Bigot, 1861) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records659

Data sources7

Biological traits0

DNA specimens109

eDNA detections24

Sources7 archives

Databases and archives Aedes vittatus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility659 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics109 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF659 records

Environmental DNA1 datasets · 1 countries24 detections

DNA & barcodingBOLD109 specimens

01Narrative

Aedes vittatus is a species of mosquito that was first described in 1861 as Culex vittatus from specimens collected on Corsica. In 2000, the species was transferred to the newly erected subgenus Fredwardsius as the type (and only) species representing the subgenus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding109 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes vittatus has left across the world's sequence archives.

At a glance

DNA specimens109

BINs3

Marker genes4

eDNA detections24

Countries20

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P634 bp consensus100 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

25Amostly conserved

31Tmostly conserved

32Amostly conserved

34Amostly conserved

64Avariable

262Amostly conserved

289Cvariable

295Amostly conserved

298Avariable

319Tmostly conserved

334Avariable

391Gmostly conserved

409Amostly conserved

448Amostly conserved

493Tmostly conserved

509Cmostly conserved

541Amostly conserved

592Cmostly conserved

610Tmostly conserved

TTGATCAGGAATAGTTGGAACTTCATTAAGTATATTAATTCGTGCTGAACTTAGTCATCCTGGAATATTTATTGGAAATGACCAAATTTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes25

BINs3

Most divergent pair2.5%

AfricaEuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes argenteopunctatussame genus6.3%Aedes lineatopennissame genus6.3%Aedes tarsalissame genus7.4%Aedes dentatussame genus7.4%Aedes quasiunivittatussame genus7.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-3P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type659 records

Wild obs. + sensor267

Museum / vouchered392

Range

Area of Occupancy AOO544 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 1≤1 km 1>10 km 3

5 georeferenced · 262 without coordinates

Open the mapobservation + sensor267

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 391 without coordinates

Open the institutions mapphysical evidence392

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	357
QSBG/BMNHlocation not on record	3
Cape Town, ZA	2
Unikinlocation not on record	2
University of Queensland Insect Collectionlocation not on record	2
New Haven, US	1

6 institutions · 367 of 392 vouchered records shown · 25 without an institution code

09Environmental DNA24 detections

Where the DNA of Aedes vittatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.3 °C 25.3–25.3

Seasonal swing summer↔winter5.30 °C

Max temp (day)29.8 °C

Min temp (night)20.7 °C

Precipitation78.7 mm/mo

Air humidity61.2 %

Moisture balance-80.5 mm/mo

Vapour deficit1,261 Pa

Wind speed3.20 m/s

Cloud cover32.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)