Aedes lineatopennis

(Ludlow, 1905) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records195

Data sources7

Biological traits0

DNA specimens25

eDNA detections20

Sources7 archives

Databases and archives Aedes lineatopennis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility195 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF195 records

Environmental DNA1 datasets · 3 countries20 detections

DNA & barcodingBOLD25 specimens

01Narrative

Aedes (Neomelaniconion) lineatopennis is a species complex of zoophilic mosquito belonging to the genus Aedes. It is found in Oriental Regions such as India, Sri Lanka, and also in Eastern & Southern Africa, Nigeria, Japan, Malaysia, and Australia. Female has a wing length of 4 to 5mm. Head scales golden, curved and narrow. Male with tentacles over long beak, distal with wool.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes lineatopennis has left across the world's sequence archives.

At a glance

DNA specimens25

BINs3

Marker genes1

eDNA detections20

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 61 variable positions, in barcode order

8Tmostly conserved

29Tmostly conserved

38Avariable

44Tmostly conserved

47Amostly conserved

48Tmostly conserved

57Tmostly conserved

65Amostly conserved

80Tvariable

83Amostly conserved

86Amostly conserved

104Cmostly conserved

134Tmostly conserved

167Amostly conserved

203Tmostly conserved

212Amostly conserved

233Cmostly conserved

257Cvariable

269Tmostly conserved

272Tmostly conserved

284Tmostly conserved

288Cmostly conserved

290Tmostly conserved

314Amostly conserved

317Amostly conserved

320Gvariable

332Amostly conserved

341Cmostly conserved

344Tmostly conserved

350Tmostly conserved

353Tmostly conserved

356Amostly conserved

359Amostly conserved

362Tmostly conserved

365Tmostly conserved

368Tmostly conserved

377Avariable

389Tmostly conserved

395Tvariable

422Tmostly conserved

431Gvariable

449Amostly conserved

455Amostly conserved

470Tmostly conserved

473Amostly conserved

476Amostly conserved

482Tmostly conserved

492Tvariable

497Avariable

498Tmostly conserved

512Tvariable

534Cmostly conserved

536Tvariable

545Tmostly conserved

554Amostly conserved

594Tmostly conserved

614Cmostly conserved

626Amostly conserved

632Cvariable

639Cvariable

644Tmostly conserved

CTTTATATTTTATTTTTGGAGTTTGATCTGGAATAGTAGGAACTTCATTAAGTATATTAATTCGAGCTGAATTAAGTCATCCAGGAATAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.3%

Haplotypes10

BINs3

Most divergent pair4.4%

OceaniaAsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes mcintoshisame genus3.0%Aedes unidentatussame genus4.7%Aedes circumluteolussame genus4.9%Aedes bekkuisame genus6.4%Aedes quasiunivittatussame genus6.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type195 records

Wild obs. + sensor29

Museum / vouchered166

Range

Area of Occupancy AOO364 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 9≤1 km 5>10 km 4

18 georeferenced · 11 without coordinates

Open the mapobservation + sensor29

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 11>10 km 9

20 georeferenced · 146 without coordinates

Open the institutions mapphysical evidence166

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natick, US	60
University of Queensland Insect Collectionlocation not on record	59
Washington, US	19
San Francisco, US	9
Durban Natural Science Museumlocation not on record	5
New Haven, US	4
Sydney, AU	4
Australian National Fish Collectionlocation not on record	3
SUMClocation not on record	1

9 institutions · 164 of 166 vouchered records shown · 2 without an institution code

09Environmental DNA20 detections

Where the DNA of Aedes lineatopennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.9 °C 12.6–28.7

Seasonal swing summer↔winter11.1 °C

Max temp (day)27.8 °C 16.4–31.6

Min temp (night)21.8 °C 7.40–25.7

Precipitation201 mm/mo 112–260

Air humidity62.8 % 58.0–66.4

Moisture balance45.1 mm/mo 21.7–114

Vapour deficit1,058 Pa 690–1,457

Wind speed2.90 m/s 2.30–3.00

Cloud cover42.0 % 41.1–72.8

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)