Aedes togoi

(Theobald, 1907) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records361

Data sources6

Biological traits0

DNA specimens131

eDNA detections123

Sources6 archives

Databases and archives Aedes togoi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility361 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI123 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics131 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF361 records

Environmental DNA1 datasets · 6 countries123 detections

DNA & barcodingBOLD131 specimens

Genome at a glanceGoaT · TreeOfSex2n = 6

01Narrative

Tanakaius togoi is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1907 door Theobald.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding131 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes togoi has left across the world's sequence archives.

At a glance

DNA specimens131

BINs7

Marker genes2

eDNA detections123

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P639 bp consensus58 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 69 variable positions, in barcode order

3Avariable

21Gvariable

31Cvariable

33Avariable

51Cmostly conserved

63Tvariable

66Amostly conserved

87Tvariable

90Amostly conserved

96Cvariable

99Tmostly conserved

120Tmostly conserved

168Tmostly conserved

174Tmostly conserved

183Tmostly conserved

187Tvariable

201Cvariable

247Tmostly conserved

252Tvariable

261Amostly conserved

268Cmostly conserved

276Amostly conserved

279Tmostly conserved

282Tmostly conserved

288Avariable

294Cvariable

297Amostly conserved

303Tvariable

306Tvariable

315Amostly conserved

324Tvariable

330Cvariable

333Tmostly conserved

336Tmostly conserved

354Amostly conserved

360Amostly conserved

382Tmostly conserved

384Amostly conserved

393Tvariable

396Amostly conserved

402Tvariable

405Avariable

414Avariable

432Tmostly conserved

438Amostly conserved

444Tmostly conserved

447Amostly conserved

453Avariable

456Amostly conserved

474Tmostly conserved

477Amostly conserved

514Tmostly conserved

523Tmostly conserved

529Tmostly conserved

531Amostly conserved

543Cvariable

558Amostly conserved

559Tmostly conserved

567Amostly conserved

576Cmostly conserved

591Cmostly conserved

597Tvariable

609Amostly conserved

615Tvariable

618Amostly conserved

621Tmostly conserved

622Cvariable

633Tmostly conserved

634Tmostly conserved

GGAGTATGATCTGGAATAGTGGGAACATCTCTAAGAATTTTAATTCGAGCCGAACTTAGACATCCAGGAATATTTATTGGTAATGATCAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.3%

Haplotypes22

BINs7

Most divergent pair7.7%

N.AmericaAsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes dorsalissame genus8.0%Aedes guatemalasame genus8.5%Aedes allotecnonsame genus8.6%Aedes vittatussame genus8.7%Aedes mariaesame genus8.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Aedes togoi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 6 n = 3

Chromosome records6–62n range6median6mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 64×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Makino, S. (1951). An atlas of the chromosome numbers in Animals. Ames, Iowa, Iowa State College Press. ↗

08Occurrence & distribution

Record type361 records

Wild obs. + sensor14

Museum / vouchered347

Range

Area of Occupancy AOO148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 5≤10 km 2>10 km 1

8 georeferenced · 6 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy4% within 1 km

≤100 m 1≤10 km 13>10 km 11

25 georeferenced · 322 without coordinates

Open the institutions mapphysical evidence347

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	209
Vancouver, CA	41
New Haven, US	11
San Francisco, US	11
Cambridge, US	2
SUMClocation not on record	1
San Nicolás de los Garza, MX	1
Royal British Columbia Museumlocation not on record	1

8 institutions · 277 of 347 vouchered records shown · 1 without an institution code

09Environmental DNA123 detections

Where the DNA of Aedes togoi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found123

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 123 detections have coordinates

Open the map6 countries0

Tide PoolBeach

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C 7.40–12.3

Seasonal swing summer↔winter25.4 °C

Max temp (day)9.60 °C 9.60–15.8

Min temp (night)3.00 °C 3.00–7.50

Precipitation344 mm/mo 112–404

Air humidity64.9 % 60.3–65.6

Moisture balance263 mm/mo 21.7–289

Vapour deficit428 Pa 428–751

Wind speed2.90 m/s 2.00–3.00

Cloud cover44.6 % 41.1–47.5

CHELSA 1981–2010, ~9 km grid, at location & month of 90 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)