Aedes sollicitans

(Walker, 1856) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records4 146

Data sources7

Biological traits0

DNA specimens135

eDNA detections1

Sources7 archives

Databases and archives Aedes sollicitans's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 146 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics135 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 146 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD135 specimens

01Narrative

Aedes sollicitans, the eastern saltmarsh mosquito (also known as Ochlerotatus sollicitans), is a species of mosquito native to the eastern seaboard of the United States and Canada as well as the entire Gulf coast and is also present in the Bahamas and Greater Antilles. While primarily found in coastal areas within a few miles of the coast, it is occasionally found inland in areas with saline pools, the species was reported as far west as Arizona. The species is a prime vector for Eastern equine encephalitis, Venezuelan equine encephalitis and dog heartworm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding135 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes sollicitans has left across the world's sequence archives.

At a glance

DNA specimens135

BINs1

Marker genes1

eDNA detections1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus123 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

58Cmostly conserved

328Gvariable

340Cmostly conserved

634Tvariable

TACATTATATTTTATTTTCGGAGTTTGATCAGGTATAGTTGGTACATCATTAAGAATCTTAATTCGTGCTGAACTAAGTCAACCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.30%

Haplotypes30

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes taeniorhynchussame genus2.1%Aedes mitchellaesame genus2.4%Aedes caspiussame genus5.9%Aedes dorsalissame genus6.2%Aedes mariaesame genus6.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 146 records

Wild obs. + sensor3 327

Museum / vouchered819

Range

Area of Occupancy AOO3 784 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 392≤1 km 65≤10 km 20>10 km 41

518 georeferenced · 2 809 without coordinates

Open the mapobservation + sensor3 327

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 483≤1 km 13≤10 km 109>10 km 23

628 georeferenced · 191 without coordinates

Open the institutions mapphysical evidence819

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	338
Ciudad de México, MX	103
New Haven, US	61
Mosquitolocation not on record	59
Saint John, CA	53
San Francisco, US	44
San Nicolás de los Garza, MX	41
UNHClocation not on record	22
Washington, US	20
Chicago, US	15
Wuzhou, CN	14
Champaign, US	13
National Ecological Observatory Network, United Stateslocation not on record	9
Cambridge, US	8
Cleveland Museum of Natural History, OH (CLEV)location not on record	7
CUlocation not on record	2
Albuquerque, US	2
Mayagüez, PR	2
Ann Arbor, US	2
NEON Biorepository at Arizona State Universitylocation not on record	1
University Park, US	1

21 institutions · 817 of 819 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Aedes sollicitans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

cultivatedCrops

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.5 °C 17.5–17.5

Seasonal swing summer↔winter23.6 °C

Max temp (day)21.2 °C

Min temp (night)14.2 °C

Precipitation110 mm/mo

Air humidity57.3 %

Moisture balance-35.1 mm/mo

Vapour deficit853 Pa

Wind speed4.00 m/s

Cloud cover41.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aedes sollicitans

At a glance

Sources7 archives

At a glance

Record type4 146 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 146 records